Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-XL480a18ex.3                          4 END     2           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3398743-IMAGp.5.5             137 PI      84        194      466                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012767321 Xl3.1-IMAGE:6324599.5 - 194 ESTs
                                                                       ....-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6324599.5                                                                                                                                                                                                                                                                                                                                               GAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAAAAAAA
                                                  Xl3.1-CHK-1012685190                                                                                                                                                                                                                                                                                                                                                     GAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAAxxxAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                    9    23    30    46    44    60    42    62    57    65    58    66    59    67    59    67    60    69    60    71    60    71    62    71    62    71    64    72    66    74    66    73    66    74    67    75    68    75    67    75    67    75    67    75    67    75    69    76    69    76    69    76    70    78    71    78    70    78    70    78    72    79    72    80    73    80    73    80    72    80    72    80    72    82    73    83    73    83    73    84    75    85    74    83    73    81    73    82    75    83    73    82    72    82    73    83    70    82    69    81    68    81    70    81    70    81    68    81    69    80    61    77    61    76    60    76    64    75    56    69    55    66    49    62    39    53    38    54    37    54    34    50    32    50    29    47    31    49    31    49    32    51    34    53    32    52    38    60    34    56    32    54    34    50    37    51    31    50    35    60    44    61    44    61    43    61    44    60    43    62    41    62    44    62    47    63    46    61    51    69    52    69    49    69    52    70    54    72    54    71    54    72    53    74    55    76    59    78    63    80    67    81    70    80    69    80    71    88    80    90    79    90    82    91    80    92    83    91    84    92    83    91    82    91    84    92    85    92    79    91    82    91    81    92    84    91    80    91    84    91    75    91    81    91    80    91    77    92    86    93    72    92    71    92    75    92    71    90    69    86    65    81    42    53    30    41    24    35    17    22     9    15
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                           ACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                               CGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCTGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCGCTCACTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                   ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -G--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G-C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --G---------
                                               BLH ATG      83     781                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      83     152                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR      83     111                                                                                                                                                                                                                                                                                                                                               
                                               CDS MIN      83      50                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI      -1      50                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG      83       7                                                                                                                                                                                                                                                                                                                                               
                                                                       PROTEIN --- Dm ---- 2e-041     NP_524735.1 SoxNeuro CG18024-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-041     NP_741836.1 SOX (mammalian SRY box) related (32.2 kD) (sox-2) [Caenorhabditis elegans] -----====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---- 2e-044     XP_319093.4 AGAP009957-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 2e-048     NP_001122330.1 HMG transcription factor SoxB1 [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 2e-074     NP_999639.1 transcription factor SoxB1 [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bt ==== 1e-103     NP_001098933.1 SRY (sex determining region Y)-box 2 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 1e-116     NP_033263.2 SRY-box containing gene 3 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 3e-118     NP_005625.2 SRY (sex determining region Y)-box 3; transcription factor SOX-3 [Homo sapiens] ------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Cf ==== 4e-119     XP_549298.2 PREDICTED: similar to Transcription factor SOX-3 isoform 1 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 1e-131     NP_001001811.2 SRY-box containing gene 3 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 1e-140     NP_989526.1 SRY (sex determining region Y)-box 3 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 5e-167     Q68FA4.1 Transcription factor SOX-3 [Xenopus tropicalis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          NP_001084148.1 SOX3 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6324599.5                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------ATG---------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------ATG------------ATG------------------------ATG---------------------ATGATG---------------------ATG------------------------ATG---------------------------------ATG------------ATG---------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAG------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------TGA---TAA------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5  -1   2       bld Bla2                            IMAGE:7299499.5p                                                                                                                                NCNNCCNGccccccccccGGGCGGGGAGAAGGGACCCCACCCCCTCTCGGGGTGTTATAAAGGGGCAGTTTTTCGGGAAggggggggcaacaaaatgttgttttcttttggcccccgttttatttttttcggttttttttGGAAATTGGGGAAAAATTTTCCCCGGAAAAGTTTGCCCCATTCCCCCGGTGAAATAACCTCCTTAAGGGAAAAAAGTGGGGTTCACGCGGGGCGCCTTTTGAAATAGTGGTCCCCCGGGGGCGGGAATCCTTGGGCAGTTTTCCCCCGGAGCTCAAATGTATAGCAGGTTGAAACGGACTTCAAAGCCCCGTGCAGCAGAGCAATCACCGATCGGGGGCCCGCTACTCCGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGTGAAAGCGGCCGATGAACGCGTTTATGGTTTGTCCCGGGCCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTTCACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTGCTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCCAATATTCG
  5   1   2       bld Emb1 5g                         IMAGE:6635221.5p                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGAGCACTTGTTCATGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCCACGGTCATGAGCTTTGGCTTCCATGGGGCCTCAGTGGTTGAAAATCCCC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073363.5p                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGCCCACGCGTCCGGTTCATGAGCACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048409.5p                                                                                                                                                                                                                                                                                                                              CACGCGTCCGCGGACGCGTGGGCGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGGACAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCT
  5   1   2      seed Egg3 5g                         IMAGE:6324599.5p                                                                                                                                                                                                                                                                                                                              GAATTCCCGGGGTTCATGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGGAGATATGATCAGCATGTTACT
  5   1   2       chi Egg3                            IMAGE:6871248.5p                                                                                                                                                                                                                                                                                                                              GATTCCCGGGTGTTCATGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAANAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTTACAGTACCGACCCCGTAGGAAAGACCAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCNTGCCTCCAGGAGTAAGCCCGGTGGCTAACAGTGTCGGAGTGGGGCANAAGGAANACACTTACGCGCACATGAACCGCCTGGACTAATGGCGCTTAATTCCCTGATGCAGGACCAGTTGGGGGTAAAGCCAAAAACCCGGGCCATGAAACAGCCCCCCAAAATGCGGCGAATCCCGCCCCCGGGTTTGAACTTGGACGGGCCCTCCAGTAACAAACCCTATGGATGGACCTCTGGCCCCAAAAAGGCCCTAAATGAAAGGGGGGGTGcccccccctaaaagaaaggtccccgggctaaaaaaaaagaaaaaCTCCCCCGGGCAAGAAACTTTGGGGTTTCCCGGGGG
  5   1   2       bld Oo1  5g                         IMAGE:6643474.5p                                                                                                                                                                                                                                                                                                                               CTGGACCGGTCCGGAATTCTCGGGATGCACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCCAGGTGAAGACGCCAAGCGACCCCTCACTTC
  5   1   2       bld Oo1  5g                         IMAGE:6861121.5p                                                                                                                                                                                                                                                                                                                                    CCCGGCTGGGGTACCGGTCCNGGAATTCCTGCGGATGTTTTGAATTGGAATCTGTGTATCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCCAGCTCCCCCCCTTCAGCCATCACCTCCCACACAAAGAGGGCCTGCCTTGGGAAGACCTGCCGAGATATGATCAGCATGGTACCTGGCCCCCAGGGTGGAGAACGCCACCAACCCCTTCACTTTCAAATTAGCAAAACTGCACAGTTGTACACAAACCTTT
  5   1   2       bld Em10 5g                         IMAGE:8318328.5p                                                                                                                                                                                                                                                                                                                                     CTTGTTCATGAGCACGGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTTCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTAACAACCCTAATGATG
  5   1   2       bld Em10 5g                         IMAGE:8317751.5p                                                                                                                                                                                                                                                                                                                                      CTTGTTCATGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAATGCCTACATGAATGCCGCTGC
  5   1   2       chi Egg3                            IMAGE:6868892.5p                                                                                                                                                                                                                                                                                                                                       GATTCCCCGGGGCACGAGTTAGGATAGTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCCTGATGCAGGACCCAGTTGGGCTACAGCCCAAAACCCGGCCATGAACAGCCCCCCAGATGGCGCCAATTCCGCCCCAGGGTTGAACTTGAACCGGGCCCTCCAGTACAACCCCTAGGAATGACCCCTTGGCCCAAAAATGCCCACAACTAGATGGCCGGTGTGCCCCTCACCTTaaaaaaaagggcccccggggcctaaaaacccggggaaaaaattccccccggggttaaagaaattttgggggtcttccccggggggcccctcggggggggaaaaaaacaatngaaannnnncggggctccccccccccccccTTCCCGGGGAAGATAATTTTTTCTCCCCCCCCATaaaaacaaaaaaaaaaaGAACTTTTCCCTTCCCGGGTGTGGGGAACATCCCTCCCCNNNAATTTATTATATAttttttttt
  5   1   2       bld Emb9 5g                         IMAGE:7975511.5p                                                                                                                                                                                                                                                                                                                                       CTTGTTCTGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGNCCAAATGCCTACATGAATGCGCTGCCCTCACTACAGCATGTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048930.5p                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGCGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGAT
  5   1   2       bld Ga12 5g3  in                         XL150p22.5p                                                                                                                                                                                                                                                                                                                                          GGCTGAGGAATTCGGCACGAGGGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGG
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377973.5p                                                                                                                                                                                                                                                                                                                                           CCGGGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCT
  5   1   2       bld Gas6 5g                         IMAGE:3473638.5p                                                                                                                                                                                                                                                                                                                                           TTCATGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGACAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTT
  5   1   2       bld Oo1  5g                         IMAGE:6640408.5p                                                                                                                                                                                                                                                                                                                                            CACTTGTTCATGAGCACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCCTGCCTACAACCAGCAGAGCTCCACGGGCATGAAGCTGGCTTCCATGGGCTCAGTGGTGGAATCCGAAACCCAGTTCCCCCCCTCCAGNCAATCACCTCCCAACAACAGAGGGCCTGGCTGGGGAAACCTGGCAAAATATGATCCGCATGGTACCTGGCCCCCCGGGGGAAAAAGCCCACGGACCCTTTCCCTTCAAAA
  5   1   2       bld Ga15      out                      XL490g05ex.5p                                                                                                                                                                                                                                                                                                                                            CTTGAGCAGCAGGAGTTATAGGGAAGTTTTGTGCCGGGATCTGTGTGACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCTGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACC
  5   1   2       bld Gas8 5g3  in                    IMAGE:3516118.5p                                                                                                                                                                                                                                                                                                                                              TGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCCGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAAGTATGACATGAGCGGCCTNCAGTACAACCCTATG
  5   1   2       bld Egg3                            IMAGE:6323752.5p                                                                                                                                                                                                                                                                                                                                              GGGGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCCTATGATGAACCTCTGCCCAAAAATGGCCCTACATGGAATGGGCCGCCTGCCCTCCACCCCTACAGGCATTGTTCCCCCCTGCCCCTACCAAACCAAGGCAAGAAAGCCTCC
  5   1   2       bld Emb1 5g                         IMAGE:6864862.5p                                                                                                                                                                                                                                                                                                                                              TGAGCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTTCTGCCCAAAATGCCTACCTGAATGCCCGCTGCCTCCACCTACAGCATGTCCCCCTGCCTTACACCAGCAGAATCTCCCACGGTCCATGAACCTTGGCTTTCCATGGGGCTTCAGTGGGTGGAAAATCCGGAAACCCCGAGCTCCCCACCCCTTCCAAGCCATATTAACCTTCCCAACaaaaaaaaaaGGGGTCCTGGCCCTTGGGGGAAACACCTTGTCGAT
  5   1   2       bld Oo1  5g                         IMAGE:6639832.5p                                                                                                                                                                                                                                                                                                                                               TTGTTCATGAGCACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTATAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACNACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGGTGAAATCCGAAANCCAGCTCCCCCCCTCAGNNCATCACTCCCACACACAGAAGGCCCTGGCCTGGGGAGACCTGNCGAGATTATGATCAGGCATGTACCTGCCCCCCAGGTGGNAGACGCC
  5   1   2       bld DMZ  5g3  in                         xl291d24.5p                                                                                                                                                                                                                                                                                                                                               GAGAGAGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTC
  5   1   2       bld Egg3                            IMAGE:6322726.5p                                                                                                                                                                                                                                                                                                                                                TCCCGGGGGAGTTACGGGAAGTTTTGTGCCGGGATCTGTGTGACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCGGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAACCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACNGGTCATGAGCTTGGCTTCCATGGGGCTCAGTGGGTGAAATCNCGAACCCANGCTccccccccTCCGGGNCATCACNCTCCCACACACAGAAGGGCCCTGGCCTGGNGAGACCTGNCGGAGATNNATGATCAGCATGGTACCTGNCCTCCCAGGGTN
  5   1   2       bld Neu4 5g                         IMAGE:4084882.5p                                                                                                                                                                                                                                                                                                                                                 GCACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCATAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCATGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCATCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTTAGCCCGGTGGCTAGCAGTGTC
  5   1   2       bld Ga15 5g3  in                       XL412a15ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGG
  5   1   2       bld Ga15 5g3  in                       XL419d11ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACGTGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCANAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCA
  5   1   2       bld Ga15 5g3  in                       XL473p15ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTA
  5   1   2       bld Ga15 5g3  in                       XL512e17ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAANCCAGCAGAGCTCCACGGTCATGAGCTTGGCTT
  5   1   2       bld Ga15 5g3  in                       XL490a08ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCANATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCANTACAACCCTATGATGACCTCTGCCCAAAATGCCCTACATGAATGCCGCTGCCTCCACC
  5   1   2       bld Ga15 5g3  in                       XL512n01ex.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACA
  5   1   2       bld Em10 5g                         IMAGE:8318109.5p                                                                                                                                                                                                                                                                                                                                                  CACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGA
  5   1   2       bld Emb1 5g                         IMAGE:6631527.5p                                                                                                                                                                                                                                                                                                                                                   ACGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACNGGTCATTGAGCTTGGCTTCCATGGGGCTCAGTGGGTGAAATCCCGAAACCCAGCTccccccccTCCAGCCATCACCTTCCCACACACAAGAGGCCCCTGGCCTGGGAAGAACTTGGCCGAGAATATGGATTCAGCCATC
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3436381.5p                                                                                                                                                                                                                                                                                                                                                    CGAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCC
  5   1   2       bld Oo1  5g                         IMAGE:6639250.5p                                                                                                                                                                                                                                                                                                                                                    CATGAGCACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGGCTTCCATGGGGCTCAGTGGGTGAAATCCGAANCCCAGCTccccccccTCCCAGNCATCACCCTCCCACACACAGAAGGGGCCTGGCCCTGGGAAGACCTGGGCGAGGATATTGGATCCAGCATGGTAACCTGGCCCCCCCT
  5   1   2       bld Tbd3 5g                         IMAGE:3550151.5p                                                                                                                                                                                                                                                                                                                                                     ACGATTAGGAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGC
  5   1   2       bld DMZ  5g3  in                         xl228n01.5p                                                                                                                                                                                                                                                                                                                                                     GAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCAC
  5   1   2       bld DMZ  5g3  in                         xl267g22.5p                                                                                                                                                                                                                                                                                                                                                     GAGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGC
  5   1   2       bld Oo1  5g                         IMAGE:5078998.5p                                                                                                                                                                                                                                                                                                                                                      GAGTTAGGAAAGTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGTTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTTCACGGTCATGAGCTTGGCTTCCATGGGGCTCAGTGGTGAAATCCCGAACCAGCTCCCCCCCTCCAGNCATCACCTCCCACACACAGAGGGCCTGCCTGGGGAGACTGGCGAGATATGATCAGCATGTACCTGCCCCCCAGGTGGAGACGCCAAGCGACCCTTCACTT
  5   1   2       bld Ga15 5g                            XL454i23ex.5p                                                                                                                                                                                                                                                                                                                                                      AGTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGA
  5   1   2       bld Ga15 5g                            XL441b24ex.5p                                                                                                                                                                                                                                                                                                                                                       GTTAGGAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAANACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAAAANGACAAGTATTCTCTTCCCGGCNACCTCTTGGCTCCANGAGTAAGCCCGGCGGCTA
  5   1   2       bld DMZ  5g3  in                         xl233o04.5p                                                                                                                                                                                                                                                                                                                                                         TAGGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCC
  5   1   2       bld Ga15 5g3  in                       XL406e18ex.5p                                                                                                                                                                                                                                                                                                                                                          CACGAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAG
  5   1   2       bld DMZ       out                        xl272d23.5p                                                                                                                                                                                                                                                                                                                                                          GTTATAGGGAAGTTTTGTGCCGGGATCTGTGTGACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCTGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCC
  5   1   2       bld DMZ                                  xl263b02.5p                                                                                                                                                                                                                                                                                                                                                          GTTATAGGGAAGTTTTGTGCCGGGATCTGTGTGACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCTGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCC
  5   1   2       bld Em10 5g                         IMAGE:8321814.5p                                                                                                                                                                                                                                                                                                                                                           GGAAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCCACTACAGCATGTCCCCTGCCCTACACC
  5   1   2       bld Ga15 5g3  in                       XL458i20ex.5p                                                                                                                                                                                                                                                                                                                                                            GAAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACC
  5   1   2       bld Neu7 5g3  in                         XL025p08.5p                                                                                                                                                                                                                                                                                                                                                             AAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCATTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGC
  5   1   2       bld Oo1  5g                         IMAGE:6641203.5p                                                                                                                                                                                                                                                                                                                                                             GAGTTAGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGGCCTACACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCAGGGGCTCAGTGGTGAAATCCGAACCCAGCTccccccccTCCAGNCATCNACTCCCACACACAGAGGCCCTGCCTGGGAGACCTGCCGAGATATGATCAGCATGTAACTGCCCCCCAGGNTGGAGACGCCCANCGGACCCCTCC
  5   1   2       bld Eye1 5g                         IMAGE:6958241.5p                                                                                                                                                                                                                                                                                                                                                             AAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCCTCACCTACAGCATGTCCCCTGCCCTACAACAGCAGAGCTCCACGGGTCATGAAGCTTGGGCTTCCATGGGGCTCCAGTGTTGGAAATCCGAAACCCAAGCTcccccccctccaaggccatcaacctccccaaaacaaaaaaaGGGGCCCCTGCCCGGGGGGAAACCTTGGCGAAGATAC
  5   1   2       bld Ga15 5g3  in                       XL482a05ex.5p                                                                                                                                                                                                                                                                                                                                                             AAAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGG
  5   1   2       bld Ga15 5g                            XL408k24ex.5p                                                                                                                                                                                                                                                                                                                                                             AAAGTTTTGAGTTGGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCC
  5   1   2       bld Ga12 5g3  in                         XL183p18.5p                                                                                                                                                                                                                                                                                                                                                              AAGTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGTACATCAAGAGCCCCGTGCAACAGAGCAATGCACCGATCGGNGGCCCCNCTACTCCGGGGGGNAAAGGCAACGCTTCCNCCCTGGA
  5   1   2       bld Emb1 5g                         IMAGE:6634644.5p                                                                                                                                                                                                                                                                                                                                                               AGTTTTGAGTTGGAATCTGTGTGGTTGTTCACCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGGCTACAACAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTTCCCCCCCTCCAGCCATCAACCTCCCACACACCAGAGGGCCCTGTCCTGGGAAAACCTCGCGGAGATATAATTCAGCATGTAACCTGCCCCCCAGGTGGGAAAACGCCCACCG
  3  -1   2       bld Bla2      in                    IMAGE:7295838.3p                                                                                                                                                                                                                                                                                                                                                                GTTTTGAGTTGGAATCTGTGTGGCTGTGCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTATGGCGCTTATCCCTGATGCANGACCGTTGGGTACAGCCACACCCGGCATGACAGCCCCAGATGCACAATCAGCACAGTAGACTGACGGCTCAGACACCTATGATGACTCTGCCAATGCTACTGATGCGTGCTCACTAACATGCC
  5   1   2       bld DMZ  5g3  in                         xl336h16.5p                                                                                                                                                                                                                                                                                                                                                                GTTTTGAGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCAT
  5   1   2       bld Emb1 5g                         IMAGE:6634073.5p                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGAATCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGGCTCCAGTACAACCCTATGATGACCTCTGCCCCAAAATGCCTACATGAAATGGCCGCTGCCCTCCAACCTACAAGCATGTTCCCCCTGCCCTACAACCCAGCAAGAAGCTCCCACGGGGTCATGAAGCCTTTGGGCTTTCCACTGGGGGCTTCCAGGTGGGTTGGAAAAATTCCCGAAACCCCCAAGCTTTCCCT
  5   1   2       bld Emb1                            IMAGE:5154887.5p                                                                                                                                                                                                                                                                                                                                                                  GAAGTTTTGTGCCGGGATCTGTGTCACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCGGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTTCACGGNTCATGAGCTTGGCTTCCATGGGGCTCAGTGGTGGAAATCCGAACCCAGCTccccccccTCCGGCCATCACCTCCCACACACAGAAGGCCCTGCCTGGGGAGACTG
  5   1   2       bld Ga12 5g3  in                         XL216b02.5p                                                                                                                                                                                                                                                                                                                                                                  AGGAAAGTTTTGAATTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGG
  5   1   2       bld Neu7 5g3  in                         XL049h19.5p                                                                                                                                                                                                                                                                                                                                                                      GGTTGGAATCTGTGTGGTTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCC
  5   1   2       bld Egg3 5g                         IMAGE:6322470.5p                                                                                                                                                                                                                                                                                                                                                                        TCCCGGGCTGTGTGGCTGTTCAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTccccccccTCCAGCCATCACCTTCCCACACACAGAAGGGCCCTGCCCTGGGNNAAGACCTGCGAGGATATGGATTCAGGCATGGTACCCTGccccccccAAGGTGGN
  5   1   2       bld Ga12 5g3  in                         XL191n04.5p                                                                                                                                                                                                                                                                                                                                                                                TTGGAATCTGTGTAGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAA
  5   1   2       bld Emb1 5g                         IMAGE:6634671.5p                                                                                                                                                                                                                                                                                                                                                                                    TCACGCGTCCGCGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCTACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGGATGACATGAGCGGGCCTCCAGTACAACCCCTATGATGAACTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCAACTACAGCATGTCCCCTGCCTACAACCAGGAAAGCTTCCCGGGCAATGAACTTGGCCTTCCATGGGGCTCAAAGGGTGAAAATCCGAAACCAAGCTccccccccTCCCGGGCATTAACCTTCCCACACAACAGGAGGGGCCCTTGCCCTGGGGAAAAACCTGCGCCAAAATAAATGATCCCGCCATTGGGAACCCTGTGccccccccAGGGGGGAGAAGACAGGCCCACGACGGAACACCCTTTTCACTTTA
  5   1   2       bld Ga15                               XL520l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                         TGACAGCGCAGCTTTTTCTCGTGCAGTTTCCCCATCACCCGCAGCTCCAGATGTATAGCATGTTGGACACAGACATGAAGAGCCCCGTGCAGCAGAGCAATGCGCTGAGCGGGGGCCCCGGCACCCCAGGAGGCAAAGGTAATACTTCCACTCCGGATCAGGATCGGGTGAAGCGGCCGATGAACGCGTTTATGGTTTGGTCCCGGGGGCAGCGCAGAAAGATGGCTCAGGAGAACCCCAAAATGCACAACTCTGAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAGCCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAAC
  5   1   2       bld Ga15 5g3  in                       XL415h02ex.5p                                                                                                                                                                                                                                                                                                                                                                                              CGGCTTTCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCANCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACC
  5   1   2       bld Ga12 5g3  in                         XL184p18.5p                                                                                                                                                                                                                                                                                                                                                                                                   ATCTCGTGCAGTTTCCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCC
  5   1   2       bld Ga12 5g3  in                         XL209n13.5p                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACCTGCAGCTCCAAATGTATAGCATGTTGGACACCGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCC
  5   1   2       bld Ga12      in                         XL179p01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATGTTGGACNCCGACNTCAAGANCCCCGTGCAGCANAGCANTGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAANATGGCCCA
  5   1   2       bld Ga15      out                      XL491a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGACACCGACATCAAGAGCCCCNTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCANGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCNGNGCCAGCGAANAAAGATGGCCCANGANAACCCNAAGATGCACAACTCNGAGATCAACAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCNACGAGGCCAAGAGGCTGANAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGT
  5   1   2       bld DMZ       in                         xl295d05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGACATCAAGAGCCCCGCTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCGTACTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACNAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAANAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGG
  5   1   2       bld Oo1                             IMAGE:5083946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACATCAAGAGCCCCGTGCAGCAGAGCAATGCACCGATCGGGGGCCCCGCTACTCCGGGAGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACGTGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGGCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCAGTACACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGGCTCCAGCTACAGCATGTCCCCTGGCTACAACCAGCAGAGCTCCACGGCCATGAGCTTTGGCTTCCATGGGGCTCCATGGTTGGAAATTCCAAACCCAAGTTccccccccTCCAGGCAATTACCCTCCCAAAAAACAGAAGGGCCCTGGCCTGGGGGAGACCCTGCCNAAGATATGGATCAAGCTTTGGTACCTGGCCCCCACGGTGGGAAGAAGCCCCAAGCGACCCCTTTTCCTTTCAAAAAATAGACAAGAACTGGCCCCAGGTGGTAACACCCAAACCCCTTTCCCCAAAGAGGGGCGGCCCGGGCCCCCTGGGAAGGTCCAATTGGGGCA
  5   1   2       bld Ga15      in                       XL448n05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCGGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCA
  5   1   2       bld Egg5      in                    IMAGE:3430528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTTTCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTG
  5   1   2       bld Egg5      out                   IMAGE:3430368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGCAAAGGCAACGCTTCCACCCTGGATCAGGATCGGGTGAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCCCTGGCTTCACCTACAGCATGTTCCCTGCCTACAACCAGCAGAGCTTCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCTCCTCTCCAGCCATCACCTCCCACACACAGTAGGCCTGGCTGGGAGACCTGCGAGAT
  5  -1   2       bld Egg3                            IMAGE:6870957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGGAATCCGGGTGAAAGCCGGCCCGATGAAACCGCGTTTAATGGGTTTGGTCCCCGGGGGGCAGCCGCAGAAAGAATTGCCTCAGGGAGACCCCCAAAATGCCACAACTCGAAGATCAGCAAGCGACTGGGGGCCGACTGGAAGCTGCTCAGCGACTCCGAGAAGAGACCCTTCATCGACGAAGCCAAGAGGCTGAGGGCTGTGCACATGAAGGACTACCCGGATTACAAGTACCGACCCCGCAGGAAGACCAAGACCCTCCTGAAAAAGGACAAGTACTCCCTGCCCGGCAACCTTTTAGCTCCAGGAATCAACCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAGCACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCGGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCTCCAGGTGGAGACGCCGGCGACCATTCTTCCCTTCAGAATAGCAGACTGCATAGTGTACACCAACACTACCAGAGTGCCGGCGGCCCGGGGGTTAATGGCACGGTACCGCTCACTCACATATAATAACACTTGTCTCTTTGACTCTTTGCTTGCCTGGCAACACACTTCGTTGAACAACCACCACTTGAGGACAGTGAATCAAGGGGTGAAATGTCAAAAAAACCTGGGAATC
  5   1   2       bld Emb1                            IMAGE:6631685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGCGCCCGATGAACGCGTTTATGGTTTGGTCCCGGGGCCAGCGAAGAAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCCTGCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGGCCCTGGAGTCAATGGCACGGGTACCGCTCACTCACATATAACACTTTGGTGCCCTTTGCTAAAGAACGCCTTTACCTGGCCTGGCTGGCCACCTATCAGAACTGGCCGGCATAAAAACATTTAACAAAC
  5   1   2       bld Ga15      in                       XL470m20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCA
  5   1   2       bld Ga15      in                       XL404j18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAGATGCACAACTCGGAGATCAGCAAAAGATTGGGCGCTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCANA
  5   1   2       bld Ga15      in                       XL463c18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGACTGGAAGCTGCTCAGCGATTCCGACAAAAGACCCTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaa
  5  -1   2       bld Bla2      in                    IMAGE:7295838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTGAAGCTGCTCAGCGATTCCGACAAAAGACCNTTCATCGACGAGGCCAAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTTCACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTGCTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTAAGATTTT
  5   1   2       chi Egg3      in                    IMAGE:3377303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGAGAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAAGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAAGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCACAAACTTCCTTTTTATA
  5   1   2       bld Ga15      in                       XL427c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGCTGAGAGCTGTGCACATGAAAGACTACCCGGATTACAAGTACCGACCCCGTAGGAAGACCAAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAAC
  3   1   2       bld Ga15 5g3  in                       XL490a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTACAAGTNCCGACNCCGTAGGAAGACCAAGACTCTCNTGAAGAAGGACAAGTATTCTNTTCCCGGCAACNTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTT
  5   1   2       bld Ga15      out                      XL484n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGACTCTCCTGAAGAAGGACAAGTATTCTCTTCCCGGCAACCTCCTGGCTCCAGGAGTAAGCCCGGTGACTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATANAGCACAATATTTTATGTACTTTTTGTTTGGGGGGG
  5   1   2       bld Egg3                            IMAGE:6327125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCGGGACCAGACCCTCCTTACAAGGACAAGACTCCCTGCCCGGCTATCCCTTAGCTCCAGGAATCAACCCGGTGTCCGGCGGAGTCGGACAGAGGATAGACACTTACCCGCACATGAACGGCTGGACTAATGGCGCTTATTCGCTGATGCAGGAGCAACTGGGCTACGGCCAACACCCGGCCATGAACAGCAGCCAGATGCAGCAGATCCAACACAGGTATGACATGGGCGGCCTCCAGTACAGCCCCATGATGTCCTCTGCGCAGACTTACATGAATGCCGCCGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCGGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCTCCAGGTGGAGACGCCGGCGACCATTCTTCCCTTCAGAATAGCAGACTGCATAGTGTACACCAACACTACCAGAGTGCCGGCGGCCCGGGGGTTAATGGCACGGTACCGCTCACTCACATATAATAACACTTGTCTCTTTGACTCTTTGCTTGCCTGGCAACACACTTCGTTGAACAACCACCACTTGAGGACAGTGAATCAAGGGGTTATTTTGTACAAAAAAAGTTTGCGCAAACTTCCTTTATAGAGCACAATATTTTATGTACTTTTTGTTGGGGGGAGGGGAGGATGATGTTGTGTTGGTTCTTTTAAACCCCAGGGGGCTCCTTTATCCCACCTGAGCCAGAAACCTTCAGGNTTGTAGAAAGGTTGGGGACTATAAATGTTTTACCACCGTTTTTAAACGAACAAAGCTCCAAGGATATGAACCTTGGGGGTTTTTACTCCCAAAACCTGGTAGGGCTCTTTTATCCGC
  5   1   2       bld Emb1                            IMAGE:6637289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGCGTGGGCGGACGCGTGGGCAACCTCTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTggggggggTAGGGATGATGTGTTGGGGCTTTCAAAAACCCAGGGGACTCTAGATGTCCTTTTTATCCCATTGACCAAGGACCTGGTAACCTTTCCTTGGAACCAGT
  5   1   2       bld Ga12      in                         XL178g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCTCTTGGCTCCGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTA
  5   1   2       bld Ga15      in                       XL417n21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGCTCCAGGAGTAAGCCCGGTGGCTAGCAGTGTCGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAAAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTA
  5   1   2       bld Emb1                            IMAGE:6636398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGAGTGGGCCAGAGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGAATGATGGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGGACCTGGTAACCTTCACTTGTACCAGTTGGTGATGTTCTTAACCATAACTCCGATTTTTACACGTTTTTACCGACACGCCTCAAGAATTTACCTTGGGGNTTTTTATCCAAAACCTGTAAAATTCTTACCCGTTTGGC
  5   1   2       bld Ga15      in                       XL473j03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGATAGACACTTACGCGCACATGAACGGCTGGACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATANAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAA
  5   1   2       bld Ga15      in                       XL502e10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTAATGGCGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGG
  5   1   2       bld Ga15      in                       XL453h20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTTATTCCCTGATGCAGGACCAGTTGGGCTACAGCCAACACCCGGCCATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATANAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAG
  5   1   2       chi Emb1                            IMAGE:6636046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAACAGCCCCCAGATGCAGCAGATCCAGCACAGGTATGACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAAGTGTGAAGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGGTTTTTATCCAAAAACTGTAAGATTTTATCGTTTTGCAttttttttttAGACTTTAACAAAAAACCTTGTGCTCGGTTCCCAAAACAAGGAACTTTTTGGGTTTGGTTCCCTTTTAAACTTAAAAGAAGGGCATATATTTTTGGGGAAAAAN
  5   1   2       bld DMZ       in                         xl316j11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATGAGCGGCCTCCAGTACAACCCTATGATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTG
  5   1   2       bld Ga15      in                       XL464f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGACCTCTGCCCAAAATGCCTACATGAATGCCGCTGCCTCCACCTACAGCATGTCCCCTGCCTACAACCAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTANATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGNACAAGTTGNGATGTTCTTAACCATAACTCNATGTTTACAC
  5   1   2       bld Ga15      in                       XL403j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATANAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTANATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACAC
  5   1   2       bld Ga15                               XL484o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAGAGCTCCACGGTCATGAGCTTGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATT
  5   1   2       bld Egg1                            IMAGE:4678300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGGCTTCCATGGGCTCAGTGGTGAAATCCGAACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTA
  3   1   2       bld Ga15      in                       XL463c18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCATGGGCTCAGTGGTGAAATCCGNACCCAGCTCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTT
  3   1   2       bld Egg5                            IMAGE:3431366.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGCTCNCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATCAAACATTTAAA
  3   1   2       bld Gas8 5g3  in                    IMAGE:3516118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL406e18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCCCTCCAGCCATCACCTCCCACACACAGAGGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGNGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ga15      in                       XL427c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCCACACACAGAGGGCCTGCCCTGGGAGNCCTGNGAGATATGATCAGCATGTACCTGCCCCCAGGNGGAGACGCCAGNGACCCTTCNCTTCAAAATAGCAGNCTGCNCAGTGTACNCCAACNCTACCAGAGNGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGNTCACTCNCATATAACNCTTTGNGCCCTTTGNTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGNCTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACATGAAAG
  3   1   2       bld Ga15 5g3  in                       XL512n01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACACAGAGGGCCTGCCTGGGNGACCTGCGNGATATGATCAGCATGTACCTGCCCCCNGGGGGAGACGCCAGNGACCCTTCACTTCAAAATAGCAGNCTGCACAGNGTACNCCAACNCTACCAGAGNGCCGCCGGCCCTGGANTCAANGGCNCGGNACCGCTCACTCACANATAACNCTTTGNGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTG
  3   1   2       bld DMZ       in                         xl316j11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCCTGCCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTG
  3   1   2       bld Ga15                               XL484o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCTGCCTGGGAGACCTGGGGAGATATGATCAGCATGTACCTGCCCCCAGGNGGAGACGCCAGGGACCCTTCACTTCAAAATAGCAGNCTGCACAGTGTACNCCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTG
  5   1   2       chi Emb1                            IMAGE:5156125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTGGGAGACCTGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGCGGGGTACGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTAAAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGCTTTTATCCAACACCGAACATTTTATCCGTCGCCttttttttAAACTTTACAAAAAAACCTGTGCGGGTCGCCAACAAGGACTTTTTTGTCCCGGTCCTTTTTACCTTATACCCAGGTATATAATTTTTGAGGCAACCCACTTTTTTTACCCCCCTTTGGCTTCCGCATTTACCCGAGAAATCGGCTTAAACCTATCCCAACCCCCCAAATTGCCTTAAAATTGCGCCCACCTGGGCCTCTCCCAAAAAAACCTCCGAAACCGACACGTCGCCAAAACCCACCCCGACGAAAACTCTTTTTCTTGTTAAGGCATGGGCGAAACTAGCCACTCCAAACCAAGGCCGAGATTCCTTCCCGCACAGCAATCCGCCCCACCGCGGTACCCCCAGAATTTTACACCCCATCCACCTG
  3   1   2       bld Ga15      in                       XL403j24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGATATGATCAGCATGGNACCTGCCCCCAGGGGGAGACGCCAGNGACCCTTCACTTCAAAATAGCAGNCTGCACAGNGTACNCCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGCTCACTCACATATAACNCTTTGNGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGAC
  3   1   2       bld Ga15      in                       XL404j18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAAT
  3   1   2       bld Ga15      in                       XL446l01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGNGACCCTTCACTTCAAAATAGCAGACTGCNCAGTGTACNCCAACNCTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld DMZ  5g3  in                         xl336h16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGGGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGAC
  5   1   2       bld Ga15      in                       XL446l01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTANATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAAATTTTATCGTTTGCAttttttttAAACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGactttttgttttgttcttttaacttatantatgtatatattttgtgaaatccactttttTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTANATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAAC
  3   1   2       bld Ga15 5g3  in                       XL412a15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGATATGATCAGCATGTACCTGCCCCCAGGTGGAGACGCCAGNGACCCTTCACTTCAAAATAGCAGNCTGCNCAGTGTACNCCAACNCTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGNGCCCTTTGNTAAAGNCGCTTTACTTGCCTGCTGGCAACTATCAGNCTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ga15      in                       XL473j03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNGATATGATCAGCATGTNCCTGCCCCCAGGTGGNGACGCCAGCGACCCTTCACTTCAAAATAGCAGACTGCNCAGTGTACNCCAACNCTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTNGTTTTGTTCTTTTAACTTATAGTATGTATATATTTNGNGAAATCCACTTTTTTCCCCCTTNGGTTCGTATTTACTGNGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACATGAAAGAAACGACA
  3   1   2       bld Ga15 5g3  in                       XL512e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATGATCAGCATGTACCTGCCCCCAGGTGGNGACGCCAGNGNCCCTTCNCTTCAAAATAGCAGACTGCNCAGNGTACNCCAACNCTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGNTCACTCNCATATAACNCTTTGNGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  5  -1   2       bld Bla2                            IMAGE:7296259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGACTGGATATAGATAGCATCTCCGCCCCAGGGGAGAGCCAGCGACTTCATTCAAATAGCAGATGCACAGTGTACACCACACTACCAGAGGCCGCCGGCCCGGAGTCAAGGCACGGTCCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAGCTGTGCGGGTCGCAAACAGGACtttttgttttgttcttttaacttatagtatgtatatattttgtgaaatccacttttttcccCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCCCCAAGAAGTC
  5   1   2       bld Ga15      in                       XL471d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCACTTCAAAATAGCAGACTGCACAGTGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATANAGCACAATATTTTATGTACTTTTTGTTTggggggggTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTANATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAANATTTACTTGGGTTTTTATCCAAAACTGTANATTTTATCGTTTGCAttttttttANACTTTACAAAAAAGCTGTGCGGGTCNCAAACAGGACTTTTTGTTTTNNTCTTTTAACTTATANNATGNATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCNNATTTACTGNGAATTGTTTAACATATCANCCCACAAATGCTTTANATTGNTTTACTGGGTTTCTAAAAACTTTGACNTGAAANNAAACNACNTACTCNNTAAATTTTTCT
  3   1   2       bld Ga15      in                       XL471d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCACTTCAAAATAGCAGACTGCACAGNGTACNCCAACNCTACCAGAGNGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGNGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTT
  3   1   2       bld Ga15 5g3  in                       XL482a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCAAAATAGCNGNCTGCNCAGNGGTACNCCAACCCTACCNGAGTGGCCGCCGGCCCTGGAGTCAANGGCNCGGTACCGCTCNCTCNCANATAACNCTTTGNGCCCTTTGNTAAAGACGCTTTACTTGCCTGNTGGCAACTATCAGNCTGCCGCATAAAACNTTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTT
  3   1   2       bld DMZ  5g3  in                         xl228n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCAAAATAGCAGACTGCACAGTGTACACCAACNCTACCAGAGTGCCGCCGGCCCNGGAGTCAATGGCACGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGA
  3   1   2       bld DMZ  5g3  in                         xl233o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAAAATAGCAGACTGCACAGNGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACNTTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTG
  5   1   2       bld DMZ                                  xl288k13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATAGTGTACACCAACACTACCAGAGTGCCGGCGGCCCGGGGGTTAATGGCACGGTACCGCTCACTCACATATAATAACACTTGTCTCTTTGACTCTTTGCTTGCCTGGCAACACACTTCGTTGAACAACCACCACTTGAGGACAGTGAATCAAGGGGTTATTTTGTACAAAAAAAGTTTGCGCAAACTTCCTTTATAGAGCACAATATTTTATGTACTTTTTGTTgggggggggggNAG
  3   1   2       bld DMZ  5g3  in                         xl267g22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNGTACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCNCATATAACNCTTTGTGCCCTTTGCTAAAGNCGCTTTACTTGCCTGNTGGCAACTATCAGNCTGCCGCATAAAACNTTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTCAAAGACTTG
  3   1   2       bld DMZ       in                         xl295d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACCAACACTACCAGAGTGCCGCCGGCCCCGGAGTCAATGGCNCGGTACCGCTCACTCACATATAACNCTTTGTGCCCTTTGCNAAAGACGCTTTACTTGCCTGNTGGCAACTATCNGACNGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACCTGNGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ga15 5g3  in                       XL419d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACNCCAACNCTACCAGAGNGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGCTCACTCACANATAACNCTTTGNGCCCTTTGNTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGA
  3   1   2       bld DMZ  5g3  in                         xl291d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACACCAACACTACCAGAGTGCCGCCGGCCCNGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGAC
  3   1   2       bld Neu7 5g3  in                         XL049h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAANACGCTTTACTTGCCTGCTGGCAACTATCANACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACANAAAGTAAACGACATACTCAATAAA
  5   1   2       bld Ga15      in                       XL499h24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACACCAACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCACTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTANATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAANATTTACTTGGgtttttatccaaaactgtaaattttatcgtttgcattttttttAAACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATANNATGNATATATTTTGNGAAATCCACTTTTTTCCCCCTTTGCTNCNNATTTACTGNGAATTGTTTAACNTATCNNCCCNNNNATGCTTNANATTGNTTTACTGGGNTTCNNNNNACTTTNAC
  3   1   2       bld Ga15      in                       XL499h24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACACCAACNCTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGCTCACTCACATATAACNCTTTGNGCCCTTTGNTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACCATGAAAGAAACGACAT
  3   1   2       bld Ga15      in                       XL453h20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACNCCAACNCTACCAGAGGGCCGCCGGCCCTGGNGTCAANGGCNCGGTACCGCTCACTCACANATAACNCTTTGNGCCCTTTGNTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGNCTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTT
  3   1   2       bld Ga15      in                       XL417n21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNCCAACACTACCAGAGNGCCGCCGGCCCTGGAGTCAATGGCNCGGTACCGCTCNCTCNCATATAACNCTTNGTGCCCTTTGNTAAAGACGCTTTACTTGCCTGNNGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGAAACGACA
  3   1   2       bld Neu7 5g3  in                         XL025p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACACTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAANACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTCGACANAAAGTAAACGACATACTCAATAAATTTT
  3   1   2       bld Ga12 5g3  in                         XL216b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACCAGAGTGCCGCCGGCCCTGGAGTCAATGGCACGGTACCGCTCACTCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTATAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAATA
  3   1   2       bld Unk4                                726_21L03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGCCCTGGAGTCAATGGCACGGTACCGCTCAATCACATATAACACTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCCCTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTTTAAATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTTTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGG
  3   1   2       bld Ga12 5g3  in                         XL184p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCACATATAACNCTTTGTGCCCTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACNCAAAAATT
  3   1   2       bld Ga15      in                       XL448n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATATAACACTTNGTGCCCTTTGNTAAAGACGCTTTACTTGCCTGNTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTG
  5   1   2       bld Ga15      in                       XL497b03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTGCTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCNCTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCNCAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGNGTTGGGCTTTCAAAANCCCAGGGACTCNAGANGNCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTANATTTTATCGTTTGCAttttttttAAACTTTACAAAAAAGCTGNGCGGGTCNCAAACAGGactttttgttttgttcttttaacttatagtatgtatatattttgtgaaatccactttttTCCCCCTTTGGTTCGNATTTACTGGGAATTGTTTAACATATCAACCCNCAAATGCTTTANATTGNTTTACTGGGTTTCTAAANACTTTGNCNTGAAAG
  3   1   2       bld Ga15      in                       XL497b03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTGNTAAAGACGCTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ga15                               XL484p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAGACGCTTTACTTGCCTGCNGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTAGCTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACA
  5   1   2       bld Ga15      in                       XL476b15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTaaaaaaaaaaaTCCNCCTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGNGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTANATTTTATCGTTTGCAttttttttANACTTTACAAAAAAGCTGNGCGGGTCNCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGNATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTATGGTTCGTATTTACTGNGAATTGTTTAACATATCAACCCNCAAATGCTTTAAATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCNATAAATTTTTCTATGAGGAATGTaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL150p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTGCCTGCTGGCAACTATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTGTTCTTTTAACTNATAGTATGTATATATTTTGTGNAATCCACTTTNTTCCCCCTTTGGNTCGTATTTACTGTGAATTGTNNTAACATATC
  3   1   2       bld Ga12 5g3  in                         XL183p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCAGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAAT
  3   1   2       bld Ga12      in                         XL178g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCNTTGGTTCGTATTNACTGTGAATTGTTTAACANATCAACCCACAAANGCTTTAGATTGTTCTCACTGGGTTTCGTAAA
  3   1   2       bld DMZ                                 rxl227i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGCCGCATAAAACNTTTAAAAAAAAAAATCCNCTTGAGGACAATGAATCAAGGGNGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCNCAATATTTTATGTACTTTTTGTTTGGGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGA
  3   1   2       bld Ga15                               XL447b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNCTGCCGCATAAAACNTTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATNTTATGTACNTNTTGTTTGGGGGGGTAGGGATGATGTGNTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACNGGGTTTCTAAAGACTTGAC
  3   1   2       bld Ga15 5g3  in                       XL473p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACNGTAGATTTTATCGTTNGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTNGTTTNGTTCTTTTAACTTATAGTATGTATATATTTNGNGAAATCCACTTTTTTCCCCCTTNGGTTNGTATTTACTGNGAATNGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTAC
  3   1   2       bld Ga12 5g3  in                         XL209n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCGCATAAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGCCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAA
  3   1   2       bld Ga15      in                       XL464f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCNGCATAAANCATCTAAAAAAAAAAATCCACCTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGA
  3   1   2       bld Ga15                               XL454a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGCATAAAACATTTAAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTGGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTNGTTTNGTTCTTTTAACTTATAGTANGTATATATTTTGNGAAATCCACTTTTTTCCCCCTTNGGTTCGTATTTACTGNGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTA
  3   1   2       bld Ga12      in                         XL179p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNAAACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAANCCCAGGGACTNTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACANGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTNGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATA
  3   1   2       bld Egg5      in                    IMAGE:3430528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCCATAAATTTTTCTATGAAA
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3436381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTAAAAAAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTTGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTTTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTTTATGAGGAAAAAAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAA
  3   1   2       bld Ga12 5g3  in                         XL191n04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAATCCACTTGAGGACAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAATAAAT
  3   1   2       chi Ga15                               XL435h08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGNTTTTTTTGCNGGNTCCCCNCGANTTGAANTTGTNGNCCCCCNNGNCCGGNTTTANATNGNGNGNGGCCCCCCNTTTTTTTTTTTTTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGA
  3   1   2       bld Ga15      out                      XL441c18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGGAATCAAGGGNGTAATTTNGTACAAACGTTTGCGCAAACTTCNTTTTTATAGAGCNCAATATNTNANGTACNTTNTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTAGCTGTGAATTGTTTAACATATCAACCCCACAAATGCTTTAGATTGT
  3   1   2       bld Egg6                            IMAGE:4432839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTA
  3   1   2       bld Ga15                               XL401d24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAATCAAGGGTGTAATTTTGTACAAACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTANGTACTTTTNGGNGTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTNGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACANATGCTTTAGATT
  3   1   2       bld Ga15 5g3  in                       XL415h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNGNACAAACGNTTGCGCAAACTTCCTNTTNATAGAGGCAGCAATATTTTATGTACTTTTTGTTNGGGGGGGTAGGGANGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGNGAAATTGTTTAGACATATC
  3   1   2       bld Bla1                            IMAGE:3379781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTTTGCGCAAACTTCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGTTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAA
  5   1   2       chi Ga15      out                      XL499i03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTACTGTACCTAATCATGTATGAACCCGCGCTGGCAAGGGATTTCCTGCAGTCTGTTGGTGGTGCGGTGTCTGTGCCAGAAGACGGGTTATTCTGTGACGGAGCGAGACGAACATGACTTCCACTCACAGTTTCCAGGGGCTGGATTCCGAGGCTAAGCCGAGCTCGAGAGTATTAAAACCCCCAGGAGGTGGATCAAGCTGTATTTTTGGTGGCTCAGAAGAAACCTCTGCTCCCAGCAAGCAGCACAAGATGGCTTCCAACATATTTGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaa
  3   1   2       bld Egg3 5g3  in                    IMAGE:3377973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTTTTTATAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATA
  5   1   2       bld Egg1                               PBX0111C01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGAGAGCACAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGactttttgttttgttcttttaacttatagtatgtatatattttgtgaaatccactttttTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAATAAATTTTTCTATGAGGAATGTaaaaaaaaaaaaaaaaagaaaaaaaa
  3   1   2       bld Ga15      in                       XL476b15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTATAGAGCACAATATTTTATGTACTTTTTGNNNGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACNGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGNGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGNGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACCNGGGTTTCTAAAGACT
  3   1   2       bld Egg1                            IMAGE:3301751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATATTTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAATAAATTTTTCTATGAGGAATGTAAAAAAAAA
  5   1   2       bld Ga15      in                       XL413g06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTATGTACTTTTTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL413g06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTATGTACTTTTNGGGTGGGGGGGTAGGGATGANGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTATCTGTGAATTGTTTAAGCATATCAACCCAGCAAATGCTTTAGACTTGTTTTAGCTGGG
  3   1   2       bld Egg3      in                    IMAGE:3377303.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACTTTTTGTTTGGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACAT
  3   1   2       bld Emb1                            IMAGE:3402177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTTTGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGNTTTCTAAAGACTTNTGACATGAAAGTAAACGGCATACTCAATAAATTTTTCTATGAGGAAA
  3   1   2       bld Ga15      in                       XL502e10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTNGGGGGGGTAGGGATGATGTGTTGGGCTNTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGNCCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTCCCCCTNTGGTTCGTATTTATCTGTGAATTGTTTAAGCATATCAAGCCCATCAAATGCTTTATGATTGTT
  3   1   2       bld Ga15 5g3  in                       XL458i20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TNNGGGGGGGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCNGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTNGGTTCGTATTTANCTGTGAATTGTTTAANCATATCAANCCCATCAAATGGCTTTAGGATTGTTTT
  5   1   2       bld Ga15      in                       XL469b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCGGGGATAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACNCGTTTTAACGACACGACTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTNAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGNTCTTTNAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGNTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAAAAA
  3   1   2       bld Ga15      in                       XL469b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAGGGATGATGTGTTGGGCTTTCAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGAC
  3   1   2       bld Ga15      in                       XL454e02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGNGANGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGGTTTTTATCCAAAACNGTAGATTTTATCGTTGGCATTTTTTTTAGACTTTACAAAAAAGCNGNGCGGGTCGCAAACAGGACTTTTNGTTTGGTTCTTTTAACTTATAGTANGTATATATTTNGNGAAATCCACTTTTTTCCCCCTTNGGTTNGTATTTACNGNGAATNGTTTAACATATCAACCCACAAANGCTTTAGATTGTTTTACGGGGTTTCTAA
  5   1   2       bld Ga15      in                       XL454e02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAACCCAGGGACTCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGactttttgttttgttcttttaacttatagtatgtatatattttgtgaaatccactttttTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAATGTaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL404a14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCGCGAGCGGCCGCCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGactttttgttttgttcttttaacttatagtatgtatatattttgtgaaatccactttttTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAATGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL404a14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCGCGAGCGGCCGCCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACATGAAAGAAACGAC
  5   1   2       bld Ga15      in                       XL500b24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGNTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL501b24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaa
  5   1   2       bld Ga15                               XL503f04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGAATGTATTTGAGACTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL500b24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ga15      in                       XL501b24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTT
  3   1   2       bld Ga15      out                      XL502b24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTAGATGTCCTTTTTATCCCATNGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCCCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTNGTGAAATCCACTTTTTTCCCCCTNTGGTTCGTATTTAGCTGNGAAGTTGTTTAANCATATGCAANCCCACAAATGCNTTA
  3   1   2       bld Ga15      in                       XL457i01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACA
  3   1   2       bld Ga15                               XL458i01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTTTTTATCCCATTGACAAGGACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTNGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTNGTTCTTTTAACTTATAGTANGTATATATTTTGNGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTAGCTGNGAATTGTTTAACATATCAACCCACAAATGCTTTAGATT
  5   1   2       bld Ga15      in                       XL487f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCAttttttttAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL487f23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTGGTAACCTTCACTTGTACAAGTTGTGATGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACTTGTACAAGTTGTGACGTTCTTAACCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGGGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGGCATACTCAATAAATTTTTTTATGAGGAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga15                               XL411o23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATAACTCGATGTTTACACGTTTTAACGACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACT
  5   1   2       bld Ga15      in                       XL434o12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCCGGACACGCGTCAAGATTTACTTGGGTTTTTATCCAAAACTGATAGATTTTATCGATTTGCATTTTNTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGGTTTGTTCTTTTAACTTATAGTATGTATATATTTTGTGAAATCCNCTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTANATTGTTTTACTGGGTTTCNANAGACTTTGACATGAAAGTAAACGACATACTCAGTAAATTTTTCTATGAGGaaaaaaaaaaaaaaaagnaaaaaaaaa
  3   1   2       bld Ga15      in                       XL434o12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACGCTCAAGATTTACTTGGGTTTTTATCCAAAACTGTAGATTTTATCGTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTTGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGNGAAATCCACTTTTTTCCCCCTTNGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTGACATGAAA
  3   1   2       bld Ga15      in                       XL470m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTGCATTTTTTTTAGACTTTACAAAAAAGCTGTGCGGGTCGCAAACAGGACTTTTGGTTTTGTTCTTTTAACTTATAGTATGTATATATTTTGNGAAATCCACTTTTTTCCCCCTTTGGTTNGTATTTACTGNGAATNGTTTAACATATCAACCCACAAATGCTTTAGAT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTGTGAAATCCACTTTTTTCCCCCTTTGGTTCGTATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTAGATTGTTTTACTGGGTTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTTTTTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL457i01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTTTTCCCCCTTTGGGTCGGATTTACTGTGAATTGTTTAACATATCAACCCACAAATGCTTTANANTGGTTTACTGGGNTTCTAAAGACTTTGACATGAAAGTAAACGACATACTCAATAAATTTTTCTATGAGGaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)