Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL438h22ex.5                        218 PI      91         74     1404                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6868007.5                     106 PI      73        412      923                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4054965-IMAGp.5                37 PI      73        412      923                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012767337 Xl3.1-xlk138g05ex.3 - 136 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk138g05ex.3             TGAGTGTGCGGAAGTGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685370                   TGCGGAAGTGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                  3     3     4     4     4    11    24    32    38    47    43    55    47    58    50    60    50    61    53    62    54    62    55    62    56    63    58    64    57    64    57    64    57    64    58    64    57    64    58    64    59    64    60    64    60    64    60    64    61    64    61    64    61    64    62    65    62    67    64    68    64    71    66    73    66    73    66    74    67    73    66    73    68    73    68    73    68    74    62    74    67    74    70    74    66    74    70    75    68    73    68    76    71    76    68    80    70    80    74    83    73    86    75    94    76    91    69    90    82    94    78    94    78    94    78    92    74    94    76    93    73    92    75    92    72    88    68    84    63    78    59    77    60    77    59    73    59    73    52    70    54    71    52    71    52    73    56    73    56    74    56    73    57    70    58    68    61    68    62    67    59    63    59    63    59    63    59    63    58    62    59    63    59    64    62    65    56    66    55    66    56    64    57    65    57    65    58    65    57    64    54    64    55    64    55    64    55    63    56    64    56    63    53    63    53    62    53    62    52    61    51    59    40    58    38    58    37    58    33    55    32    54    20    37    14    23    12    20    12    20     6    13     5    10
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTGGGTAAGTTTCAGACCCTCTGTCTATTGATTCTTTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCAACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCCTGTTATGCAGCATATGGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGTGAACAAAGGACTAACCAAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                               BLH ATG      81    1071             
                                               BLH MIN      81     184             
                                               BLH OVR      81      77             
                                               CDS MIN      81      57             
                                               EST CLI      34      57             
                                               ORF LNG      81       6             
  5   1   2       bld DMZ  5g3  in                         xl301l11.5p AGAGATTTAAACTGAGTGTGCGGAAGTGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAA
  5   1   2       bld DMZ  5g3  in                         xl331f09.5p AGAGATTTAAACTGAGTGTGCGGAAGTGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTNCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCNTGCT
  5   1   2       bld Te2  5g                         IMAGE:7207221.5p           ACTGAGTGTGCGGAAGTGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCANGAGACAATGTTCATGACTGTTGGGCATATTTGACGCTTTCTGCANGAACATCAGTTCCNANNAACAGCTACAGCTTGTGGGGTCACGCTATGTTCCTGCTGCTAATATGAGAATGTACCACAGAATTGAGACTTAATTGTACTGATCCCTC
  5   1   2       bld Neu7 5g3  in                         XL045l19.5p                     GCACGAGGCTAGGTTAGAAGTGTGCGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAG
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db24e11.y1                              GGGTCGACCCACGCGTCCGGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCCAATGGAAT
  5   1   2       bld Egg3 5g                         IMAGE:6868197.5p                                GGACGATTCCCGGGGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGGAGACTTTACATTTTGTAACTGGATCACACATTACACAAAAGGCTTCAAATTCGGGGACATGGAAAATGAAAGATACTTTAGGGGTGGCTAAAAGTTTTGCAATTTGGGCCGNACCCCTTTACCCCCCTGCCACCTTTTCTTTCGGGAAGAAGCTTTCCTAAAAAATTGGGAAGAAGGGGAAACCTG
  5   1   2       bld Egg3 5g                         IMAGE:6325627.5p                                   GATTCCCGGGGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCGGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGGAGAGGTGAAGGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAGGAAGGCAGAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGGCAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCAGACATACACAAAGGCTCGAATTTCGGGACATGGAAAATGAAGATACTTNAGGGTGGCTAAAGTTTTGCAATTTGGGCCGACCCTTTACCCCCNTGCACTTTTCTTTTCGGAGAGGCTTTCTAAAAATTGGGAGGAGGTAAACTGCCTGGAACAAGCATAGGTTTTAAT
  5   1   2       bld Gas9 5g                              BG409659.5p                                    CCCACGCGTCCGGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATTAATTGACCCGCTT
  5   1   2       bld Egg3 5g                         IMAGE:6870579.5p                                    CGAATTCCCCGGGGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGANATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGGTGCTAAAGTTTGCAATTGGGCCGACCCTTTACCCCTGCACTTTTCTTTCGGAGAGCTTTCTAAAATGGGGAGAAGGTAACTTGCTGAAACAGCCT
  5   1   2       bld Egg3 5g                         IMAGE:6869164.5p                                    GATTCCCGGGGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTANNGGTGCNTAAGTTTGNCAATTGGCCGACCCCTTACCCCCTGCACTTTTCTTTCGGGAGAAGCTTCTAAAAATTGGGGAGAAG
  5   1   2       bld Ov1  5g                         IMAGE:8331174.5p                                     CCCACGCGTCCGGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCCAAAACCAGCTACAGAA
  5   1   2       bld Egg3 5g                         IMAGE:6326213.5p                                      GATTCCCGGGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGANATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATGGGAGACTTTACATTTGTAACTGATCACACATACACAAGGGCTCANATTCGGGACATGGNAAATGAAGATACTTANGGGTGCNNTAAAGTTTGCAAATTGGGNNCGACCCCTTACCCCCTGGCAACTTTTCTTNCGGGAGAA
  5   1   2       bld Egg3 5g                         IMAGE:6871541.5p                                       TCCCGGGGGTGAAGAGGTTTGTACTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGAAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTANGGGTGCTAAAGTTTGCAATTGGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTNCTAAAATTTGGAAAGGTAAACTGGCTTGAAACA
  5   1   2       bld Oo1  5g                         IMAGE:5085357.5p                                        CCGCGTCCGGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTNAATATGAAGAGATGTACCCACCANGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGGAAATGAAGNATACTTNANNGGTGCTAAAGTTTTGCAATTTGGGCCGAACCCCTTACCCCCCTGCACTTNTTCTTCCGGGAA
  5   1   2       bld Egg3 5g                         IMAGE:6870575.5p                                        TCCCGGGGTGGAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACTTTTGTAACTGATCACCCTTACACAAAGGCTCAAATTCGGGGACATGGAAATGAAGAATCTTAAGGGGGCTAAAGTTTTGCAATTGGGCCGAACCCTTAACCCCTGGCATTTTCCA
  5   1   2       bld Egg3      in                    IMAGE:3377941.5p                                         CCGGGGGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACTTTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAAGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCAT
  5   1   2       bld Oo1  5g                         IMAGE:6638634.5p                                         TTCAATAAGAGGAGGTTTGTAGTGAAGCTTACCGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTCTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGNAAATGAAGATACTTAGGGGTGCTAAAGTTTTGCCAATTGGCCGACCCCTTACCCCCTGCACTTTTCTTTCGGGAGAAGCTTTCTAAAATTGGGAAGAAG
  5   1   2       bld Egg3 5g                         IMAGE:6323335.5p                                          CCCCGGGTGGAGAGGTTTGTATTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAAATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCNGGGACATGNGAAATGAAAGATACNTTAGGGTTGCTAAAAGTTTTGCAAATTGGA
  5   1   2       bld Ov1  5g                         IMAGE:8330978.5p                                              GGTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAAGACCCTTGATGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGGAATTTACAGGCAACATGCGTGCCTTTTTGATTGATTGGCTGGTCCCTGTGCAAATGAATTTAATCCTGCTGCAGGAAAACATGGTTCATGAATGTTGGCATAATTGAACAGCTTTTTGCCGG
  5   1   2       bld Oo1  5g                         IMAGE:6861039.5p                                               GTGAAGAGGTTTGTAGTGAAGTTCACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAAAACAATGTTCATGACTGTTGGCCTAATTGACCGCTTTCTGCAGGAACATCCAGTTTCCCAAAAACAGCCTACCGGCTTGTGGGGGTCACGGGCTAAGTTTCCTGGCCGGCTCAATTTGGACAAGATGTACCCCCCCTTAAATTGGGAGACTTTTACTTTTGCAAACCTGATCACCCATTACCCCAAGGGTTCAAATTCCGGGACATGGGAAATGGAACAATCCTTTGGGGGGCTAAAGTTTGCTAATTTGGCCCAACTCTTTACTCCCTGGCCTTTTTCTTTTGGAAAACTTTTCTATAAATTGGCAAAGGGATAC
  5   1   2       bld Int2 5g                         IMAGE:8531274.5p                                               GTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTGCTGCTAATATGAAGGATGTACCACCAGAAATGGAGACTTACATTGTACTGATCACCTACCAAGGCTCAATCNGGACATGAATGAGATCTAGGTGCTAGTTTGCATGCGACCTACCTGCCTCT
  5   1   2       bld DMZ  5g3  in                         xl224g22.5p                                               GTGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGTGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTT
  5   1   2       bld Ooc3      in                    IMAGE:3437495.5p                                                TGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGANGATGCACAAG
  5   1   2       bld Ov1  5g                         IMAGE:5048516.5p                                                TGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGCTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAA
  5   1   2       bld Ga15 5g3  in                       XL512l07ex.5p                                                TGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAAAATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAAATGAAGAT
  5   1   2       chi Em10                            IMAGE:8320162.5p                                                GATAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGACGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATCCCTCTACTGCATGAGACATGTTCATGACTGTGGCATATTGACCGCTTCTGCGGAACTCCATTCCAAAACCACTACGCTTGTGGGGCACGCTAGTCCTTGTCTAATTGAGAAAGTCCCCCAAATGGAACTTTTTTGACTGTCCCCTACCAGGTCAATCGAATGAATAAACTAGGGTAATTCATGCACCTCCCGCTTTGAACTTA
  5   1   2       bld Thy  5g                         IMAGE:8551165.5p                                                TGAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACAGCTACAGCTTGTGGGGGTCCGGCTATGTTCCTGCTGCTAATATGAAGGATGTACCCACCAGAATTGAGACTTACATTGTACTGATCCACTAACAAGGCTCAATTCGGACTGAATGAGATCTAGGTGCTAGTTTGCATGCGACCTACCTGCCTTCTCGAAGCTCAATGAAGTACGTGA
  5   1   2       bld Ga18 5g3  in                      xlk138g05ex.5p                                                TGAAGAGGNTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGNCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTNNAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGANCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCNNGGCTATGTTCCTTGCTGCTAAATATGAAGAGNNNNACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACNCAAAGGCTCAAATTCGGG
  5   1   2       bld DMZ  5x3  out                        xl275n15.5p                                                GAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCANAAACATGCGTGGCAAATGCANAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGNANAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAANAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAANCCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAA
  5   1   2       bld Tbd3 5g                         IMAGE:3549146.5p                                                 GAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCATGTGCATATGACATTTCGTCTGCTGCATGAGACCATGTTCATGACATGTGGCATAATTGACCGCTTTCTGCATGAACATCCTAGTTCCTATAACCAGCTACAGCTTGTGGGGGTCACGGCTAATGTTCTTGCTGCTAAT
  5   1   2       bld DMZ  5g3  in                         xl238d09.5p                                                 GAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCA
  5   1   2       bld DMZ  5g3  in                         xl338c22.5p                                                 GAAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCA
  5   1   2       bld Ga15 5g3  in                       XL422h22ex.5p                                                  AAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCNCCA
  5   1   2       bld DMZ  5g3  in                         xl293f11.5p                                                   AGAGGTTTGTAGTGAAGCTGACTGCANGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAANGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCANTGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAANAGATGTACCC
  5   1   2       bld DMZ  5g3  in                         xl292h08.5p                                                   AGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGA
  5   1   2       bld Ov1  5g                         IMAGE:6317095.5p                                                    GAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGGAAATGAAGATACTTAAGGGTGCCTAAAGTTTTGCAATTGGGCCGAACCCTTACCCCCTGGCACTTTTCTTTCCGGAA
  5   1   2       bld Em10 5g                         IMAGE:8320411.5p                                                    GAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCANGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAATATGAAGAGATGTACCCACAGAAATTGAAGACTTAACATTGTAA
  5   1   2       bld Ga18      in                       xlk70p05ex.5p                                                    AGNNTTTGTAGTGAAGNTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGNCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTNNAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGNCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGNNATAATTGANCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTNCTAAATATGAAGAGNNNNACCCACCAGAAANTGGANANTTTACATTTNTNACTGATCAC
  5   1   2       bld DMZ       in                         xl333p20.5p                                                    GAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCAC
  5   1   2       bld Ga15 5g3  in                       XL473m14ex.5p                                                     AGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGG
  5   1   2       bld DMZ  5g3  in                         xl247b22.5p                                                      GGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCA
  5   1   2       bld Ga15 5g                            XL426f09ex.5p                                                       GTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAA
  5   1   2       chi Ga15      in                       XL460e15ex.5p                                                       GTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGTTTGCATCTTTTTAACCAGCTGTATGTTAACCTGACTTGAAAGGAGAACCCTCTGGTTTACACCAATCTAGTAGTGGTCCATAGAAGCCAGTTTCCTTAAACCCATGAAAGCTCCCTGCAGGCTTGTGTAATATGACTTGATGAAACGGTTCTAAAGTTGGCTCTGCAGCCACATGCTTTATGCTCACTGTCTTCTACACATCCTCTTGCCTTACAGGGCACCATATATGAAGGTCCACAATACTGCAGAGTGAAAACCTCCCATCTTGTATCCCTTTTCCAAA
  5   1   2       bld Ga15 5g3  in                       XL464l04ex.5p                                                       GTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACC
  5   1   2       bld Ga18 5g3  in                      xlk147p20ex.5p                                                       GTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGNCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTNNAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGNCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGNCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGANAATGTTCATGACTGTTGGCATAATTGANCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCNNGGCTATGTTCCTTGCTGCTAAATATGAAGAGNNNTACCCACCAGAAANTGGAGANTTTACATTTGTAACTGATCACNC
  5   1   2       bld Ga18      in                       xlk59m13ex.5p                                                        TTTGTAGTGAAGCTGACTGCAGGTTTGNGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTNCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGNCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGNCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGANCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGNNCACGGCTATGTTCCCTTGCTGCTAAATATGAAGAGANGTACCCACCAGAAANTGGNGACTTTNCATTTGNNNTGANCAC
  5  -1   2       bld Bla2                            IMAGE:7298964.5p                                                         NTTNNGNGGGGGAGGCCCACACACATccccccccACCAACCAAGAAAGTGTCGCGGGGTTTAATTTTTCCCGAAGATTTCCCTTGTTTGGGAAAATGTTGCCCCCCAACTGGGGaaaaaaaaaaGGAACCCTTGGGGAAAGGGGTTGTCCCAACCGGGTTAACCTTTTCCCCTGGGGCCTTGGAACCGGCCGGGTGAAGTCCACCAAAAAGGATTAAGCCCGCTTAAAGGTGCCAAGAAGCCAAACCTTTGGCAAATTTTGAGCCTCTTAAAGTGATAAAGGGAATGTTGCCCTAAACCTGCTCAGGTGAACCCAGCTCANCAAGCCCCATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCACCCCAATGTTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACAGaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAGATTCGGN
  5   1   2       bld Ga10 5g3  in                    IMAGE:3558032.5p                                                              AGTGAAGCTGACTGCAGGTTTGCTTGTGANAAATGTCGCTACGAGTCACCAGAACATGCTGGCANAATGCAGAAAACAATGNTGAAAACCACTTTGGCTGGAAAGAGGTTGTTGCTACCAAANAGGGTTGAGACCTCGTACAGCCTTGGNGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329294.5p                                                              GTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCANGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAATATGAAGAGATGTACC
  5   1   2       bld Gas6 5g                         IMAGE:3473232.5p                                                               TGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGTCTAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAGACCTGCTCAGGTTGAACCCAGCTTACCAATCCCAATGGAAACATCTGGTTGCCTTCCTGATGAGCTCTCACGGGCT
  5   1   2       bld DMZ  5g3  in                         xl256h01.5p                                                                    CTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAG
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744488.5p                                                                     TGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTNCAGGTGCAAATGAAATTTCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAACTGACCGC
  5   1   2       bld Neu7 5g3  in                         XL018a20.5p                                                                       GTGCAGGTTTGCGCTTGNNNAAATGTCGCTACGAGTCACCAGNAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAAT
  5   1   2       bld DMZ       in                         xl336m23.5p                                                                        AGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGT
  5   1   2       bld DMZ       in                         xl337m23.5p                                                                        AGAGGTTTGTAGTGNATNTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAG
  5   1   2       bld Ooc2 5g                         IMAGE:3746457.5p                                                                           CAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGNCGTGCCATTTGATTGACTGGCTGGTCCANGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAA
  5   1   2       bld DMZ       in                         xl304d05.5p                                                                               GAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAG
  5   1   2       bld DMZ       in                         xl275i23.5p                                                                                     CTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAG
  5   1   2       bld Ga18 5g3  in                       xlk59c22ex.5p                                                                                           AAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGNAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGNCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAANTTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTNTAACTGATCANNCATACACAAANGCTCAAATTCGGGACANGG
  5   1   2       bld Ga18      in                      xlk104f20ex.5p                                                                                             GNTAGAAGTGTGCGGTGAAGAGAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGNCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTNCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGNATAATTGANCGCTTTCTGCAGGAACATCCAGNTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGANGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACNCATACACAAANGCTCAAATTCGGGNCA
  5   1   2       bld DMZ                                  xl236a05.5p                                                                                                             ACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAA
  5   1   2       chi Emb1                            IMAGE:6864753.5p                                                                                                              GAAGAGAACATGCTGGCAAATGCAGAAAAAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACGTGTTGACAAATTGTTGGAGCCTCTTAGAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCGCGTTAAAGATGTTGATGCTGATTATGATGGCAACCCGATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCACAGAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAAGGAAATTCCGTCTACTGCAGGAAGACAATGCTTCATGACTGGTTGACTTAGTTGAACCGGCTTTTCTGGCAAGAACAGTGCCAGTTCGCCAAAAAGACCAAGTTTACAAGCTGGGTCGGAGGGGATGGCGAGCATAATGGTTTCCTTTTGCCCGGCTCAAAGTAATTAAACAGGAATGTTAACCCCTCCCAAAAAAACTTGGGAAAACATTTTGCACTTTTGGGTAACGGTGGATTCACCCTCATGTGCACAAAAGAGGGCTCAGAATTTCGGGGGAAAGTTGGAAAAATGAATAGAAGGCAACCAGCAGAGAAAAAAGAGTGCCTGCATATTTGGGGCCCGAAAGCCCTTAAGCCCCTATTTAGCCTATTCTGTCCCGGAGAAACGCTTTCTCTCAAATGTGTGGAAACAGAGGCAACATTCCCTGGNAATTAGGGCGGCCCGTTTATCCCCCCAAAATTATTCCTG
  5   1   2       bld Ooc3                   IMAGE:3436734-IMAGp.IMAGp                                                                                                                                                  TGGGATTCCCCGGGGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATA
  5   1   2       bld Ooc3      out                   IMAGE:3436734.5p                                                                                                                                                                 GAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTNTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGGTGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTGTACATTTGTTACTGATCACACATACACANAGGCTCAAATTCGGGACATTGAAATGAAGATACTTAGGTTGCTAAGTTTGCAATTGGCCGACCCTTACCCC
  3   1   2       bld Ga18      in                       xlk70p05ex.3p                                                                                                                                                                                                                                                                                                                                      ANTNATAGAAGAGANNNNTTTGCCNNNACCTGCTCANGTNGNCCCAGCTCNCCAAGCCCAATGGAAACATCTGGTTGCNNCCCTGATGNNNCTNCCAGGCTTTNTCTGNNNNCCTNATTCNCGTTAAAGATGTTGATGCTGATGATGATGNNAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTNCNTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGNCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNGCNNCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAAT
  5   1   2       bld Ov1                             IMAGE:6316266.5p                                                                                                                                                                                                                                                                                                                                                GAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCCAGGTGGAACAAAGGACTAACCAAGCATCTGACTGTTAAAGAACAAGTATGCTAGCAGC
  5   1   2       bld Ga15      in                       XL484p13ex.5p                                                                                                                                                                                                                                                                                                                                                     TTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCCAACACTCCATCACTATATGGCTTACTCTGA
  3   1   2       chi Ga18      in                      xlk104f20ex.3p                                                                                                                                                                                                                                                                                                                                                       AATNTTTGCCTAAACCTGNNNAGNNNGNNCCAGCTNNCCAANNCCAATGNANNANCTGNTTGCNNCCCTGATNNNNCTNCNAGGCTTTCTNTGNNGTCCTNNTTCACNNAAAGANNTGATGCTGATGATGATGGCAACCCAATNCTGTGCAGTGAATATNTCAAGGANATTTATGCTTNCCTGAGGAGCCTTGAGGATGNACAAGNAGTCAGACAAAACTACCTTCATGGACAGGNAGTCACAGNCAACATGCGTNNCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGNAATTCCNTCTGCTGCAGGAGNCCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNNNNCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAA
  5   1   2       bld Egg4                            IMAGE:3744971.5p                                                                                                                                                                                                                                                                                                                                                                  TGCTCAGGTTGAACCCAGCTCACCAAGCCCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATNTGTGACTGATCACACATACACAAAGGCTCANATTCGGGACATGGGAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGTCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAAATGGAGAGGTAACTGCTGAACAGCATAGTTTAACCCAATATTGGATGGAACTTGTT
  5   1   2       chi Egg3                            IMAGE:6324965.5p                                                                                                                                                                                                                                                                                                                                                                           GATTCCCGGGGGTGGAGAGGTTTGTAGTGAAGCTGACTGCAGGTTTGCGCTTGAGAAAATGTCGCTACGAGTCACCAGAAACATGCTGGCAAATGCAGAAAACAATGTGAAAACCACTTTGGCTGGAAAGAGGGTTGTTGCTACCAAACCAGGGTTGAGACCTCGTACAGCCTTGGGAGACATTGGAAACAAGGCAGAGGTGAAAGTGCCAACAAAAAAGGAATTAAAGCCAGCAGTAAAAGCTGCCAAGAAGGCAAAACCTGTTGACAAATTGTTGGAGCCTCTTAAAGTGATAGAAGAGAATGTTTGCCCTAAACCTGCTCAGGTTGAACCCAGCTCACCAAGCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATTACTTANGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCANAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGGAACAAAGGACTAACCAAGCATCTGACTGTTAANGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGC
  3   1   2       bld Ga18 5g3  in                      xlk147p20ex.3p                                                                                                                                                                                                                                                                                                                                                                                  CNAGCTCACNAANCCAATGNAAACATCTGGTTGCNTCCCTGATGNNTCTNNCANGCTTTCTCTGATNNCCTNATTCACGTTAAAGATGTTGATGCTGATGATGATGGCANCCCAATGCTGTGCAGTGNATATGTCAAGGACATTTATGCTTACNTGAGGAGCCTTGAGGATGNACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGNCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNNNNCATGTGCTTCTGTAAATAGTGTATTGTNTTTTTAATGTTTTAC
  3   1   2       bld Ga18 5g3  in                      xlk138g05ex.3p                                                                                                                                                                                                                                                                                                                                                                                   AGCTCNCCAAGNCCAATGGAAANNTCTGGTTNCCTCCCTGATGNNNNTNCCAGNCTTTCTCTGANGNCCTNNTTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTNCCTGAGGAGCCTTGAGGATGNACAAGCAGTCAGACAAANCTACCTTCATGGACAGGAAGTCACAGNCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGNNNANGTGGCATTCAAATTGTGTATTGTNGCNCCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTT
  5   1   2       bld Ga15                               XL427f09ex.5p                                                                                                                                                                                                                                                                                                                                                                                             ACCAATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCACTGCTGNGCAGNGAATATGTCANGGACNTTNATGCTTACCTGANGAGCCTTGANGATGCNCANGCAGTCANACNAANCTACCTTCNTGGACAGGAAGNCNCAGGCANCNTGC
  3   1   2       bld Egg3      in                    IMAGE:3377941.3p                                                                                                                                                                                                                                                                                                                                                                                                AATGGAAACATCTGGTTGCCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACT
  5   1   2       bld Ooc3      in                    IMAGE:3473012.5p                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCCCTGATGAGCTCTGCCAGGCTTTCTCTGATGTCCTCATTCACGTTAAAGATGTTGATGCTGATGATGATGGCAACCCAATGCTGTGCAGTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTC
  5   1   2       bld Ga18      in                       xlk51h21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGATGATGGCAACCCAATGCTNNNNNTGAATATGTCAAGGACATTTATGCTTACCTGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGNCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCANATAGCAGCTNCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTNACTCTGAAGAAGATCTAGNNCCTGTTATGCAGCATATGGNCAAGAACATCATCAAGGTGAANAAAGGACTAACCAAGCATCTGACTGTTNNG
  3   1   2      seed Ga15 5g3  in                       XL512l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGGAGCCTTGAGGATGCACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTT
  3   1   2       bld Ga15                               XL507f02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTT
  3   1   2       bld Ga18      in                       xlk51h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGNAGTNANANNAANCTACNTTCATGGACAGGAAGTCACAGNNANNATNNGTGCCATTTTGATTGACTGNCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGNCCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAANCCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNNNNCATGTGCTTCTGTAAATAGTGTATTGT
  3   1   2       bld DMZ  5g3  in                         xl301l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCAGTCAGACAAAACTACCTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCANTTTGATTGACTGGCTGGTCCAGGTGCAAATGAANTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  3   1   2       bld Ga15      in                       XL484p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCATGGACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCAAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTT
  3   1   2       bld DMZ  5g3  in                         xl224g22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCATGGACAGGAAGTCACAGGCAACATGTGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  3   1   2       bld Ga15                               XL512l15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACAGGAAGTCACAGGCAACATGCGTGCCATTTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTT
  3   1   2       bld DMZ  5g3  in                         xl256h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATT
  3   1   2       bld DMZ       in                         xl304d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGGAAGTCACAGGCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATT
  3   1   2       bld DMZ  5g3  in                         xl292h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAACATGCGTGCCATTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  5   1   2       bld Ooc2      in                    IMAGE:3746329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATTCCTTTTGATTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAG
  3   1   2       bld Te2                             IMAGE:7391734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGTGCCATTTGATTTGACTGGCTGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGGTTTTAATGTTACCGGTTAAAAGCTCA
  3   1   2       chi Ga18      in                       xlk59m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNNTTTTGNTGACTGNCTGGTCNAAGNNNNAAATNAANTTNCNNCTGCTGCAGGAGNNCANNNTCATGACTGTNGGCATAATTGACCGCTTTCTGCAGGNACATCCAGTTCCCAAAACNANCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATNAAGAGATGTACCCACCAGAAATTGGAGNCTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNCNNNATGTGCTTCTGTAAATAGTGTATTGTNTNNNTAATNTTTNC
  5  -1   2       chi Bla2                            IMAGE:7297778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAATCTTCTGAAGATCCAGCACTGGTCATTGATGATGCTGTCAGGCAATGATTCGTTGTGCAGAGACATGTCAGATGTGCATAATGACGCNTTTGCAGACATCAGTTNCCAAAACCAGCTACAGCTGTGGGGTCACGGCTATGTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCCATAGA
  3   1   2       bld DMZ  5g3  in                         xl293f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTGNCTGGCTGGTCCAGGTGCAAATGAANTTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACANGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTNTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCNTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCNCTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGACTGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTA
  3   1   2       bld Ga18                              rxlk59d01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNACNGNNGNCCAGNNGNAAATGAANTNCNTCTNCTGCNGNAGACNATGTTCATGACTGNNNGCATAATNGNCNNCTTTCTGCAGGANNNNCCAGTTCCCAAAANCNAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGNCTTTACATTTGTANCTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNANGTGGCATTCCAATTGTGTATTGTNNNNNCATGTGCTTCTGTAAATAGTGTATTGTGTTTNTAATNT
  3   1   2       bld Ga15 5g3  in                       XL464l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCAGGTGCAAATGAAATTCCGTTCTGGTGCAGGAGNNCCATGTTTCAGGACTTGTTGGCATAATTGACCGCTTTNTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTNGTGGGGGGTCACGGCTATGTTCCTTGNTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGGTGTAT
  5   1   2       bld Egg3                            IMAGE:6870923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTCCCGGGGTGCAATGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGaaaaaaaaaaaaaaaaaaaaaGCGGCCGCCAACGCCGGGGGGAACTCCCAAGCTTTTGTTCCCCTTTTATTGAGGGGTTAATTTTCGAAGCTTTGGCGCGTAAATCATGGGGTCCATAGCCTGTTTTTCCCTGGTGGGGAAAATTGGTTTATCCCGCC
  3   1   2       bld DMZ  5g3  in                         xl238d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTCCAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  5   1   2       bld Gas5      in                    IMAGE:3749628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGTTCCTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGGTAAGTTTCAGACCCTCTGTCTATTGATTCTNTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTAT
  5  -1   2       bld Egg4                   IMAGE:3743089-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGCAAAATGAAATTTCCGTCTGCTTGCAGGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTTTGCAGGAACATCCAGTTCCCAAAAACCAGGTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCTACCA
  3   1   2       bld Ga15 5g3  in                       XL422h22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGGTGCAAANGAAATTCCGTCTACTGCAGGAGACAATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAG
  3   1   2       bld DMZ  5g3  in                         xl338c22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  3   1   2       bld DMZ       in                         xl336m23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTGCAAATGAAATTCCGTCTGCTGCAGGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  3   1   2       bld DMZ       in                         xl333p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGGTAAGTTTCAGACCCTCTGTCTATTGATTCTTTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGGTGTATT
  3   1   2       bld DMZ  5g3  in                         xl247b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATT
  3   1   2       bld Ga15 5g3  in                       XL473m14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCAAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  5   1   2       bld Bla1      in                    IMAGE:3381336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATGTTCATGACTGTTGGCATAATTGACCGCTTTCTGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCATACATATGAAGATCAGCACGATTCCACAGCTGATGTCAGATGTTGTTGTGGTAATGGCCCAGCCACTCATG
  3   1   2       bld DMZ       in                         xl337m23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGACCGCTTTCNGCAGGAACATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTNGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCATNGATTCCACAGCTGTTTTTnTTTTTTTTTT
  3   1   2       bld Ga18 5g3  in                       xlk59c22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNNCCGCTTNNNGCAGGANNNNCCAGNNCCNAAANCNAGCTACAGCTNGTGGGGGTCACGGCTNNNTNCNNTGCTGCTANNANGAAGAGNNGTNCCCACCAGAAATTGGAGNCTTTANATTTGTNACTGATCACACATACACAAAGGCTCAANTTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNGCNCCATGTGCTTCTGTAAATAGTGTATTGnnnnnnAAnnnnnnCNGNT
  3   1   2       bld Ga15                               XL430e24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACATCCAGTTCCCAAAAAACCAGCTACAGCTTGTGGGGGTCANGGNTATGTTCCTTGCTGCTAAATATGNAGAGATGTACCCACCAGAAATNGGAGACTTTACATTTGTANCTGATCACACATACACAAAGGNTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCNCTTTTTTCGGAGAGCTTCTAAAATNGGAGAGGTNNCTGNTGAACAGCATAGTTTAGCCAAATATTTGATGGAACCTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAG
  3   1   2       bld DMZ  5g3  in                         xl331f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCCAGTTCCCAAAAACCAGCTACAGCTTGTGGGGGTCACGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATT
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTTCCCAAAAACCAGCTGCAGCTTGTGGAGGTCACGGCTATGTTCCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGGCAAGGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAAAA
  3   1   2       bld Neu7 5g3  in                         XL045l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCTATGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTNCCAATTGTGTATTGTTGGCACCATGTGCTTNCTGTAAATAGTGTAT
  3   1   2       bld Ov1  5g3  in                    IMAGE:8329294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTCCTTGCTGCTAAATATGAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCACATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc3      in                    IMAGE:3473012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAGATGTACCCACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTGTAATAAAGCTCATTTTAACAT
  3   1   2       bld Egg6                            IMAGE:4435076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAGAAATTGGAGACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTGT
  3   1   2       bld DMZ       in                         xl275i23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTTACATTTGTAACTGATCACACATACACAAAGGCTCAAATTCGGGACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGGTAAGTTTCAGACCCTCTGTCTATTGATTCTTTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTAT
  3   1   2       bld Bla1      in                    IMAGE:3381336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTACATTTGGATCTGCTCTCCATTCACAAATGCTCATATCGGGTCATGATATAAATATACTTAGGATGCTAAAGTTTGCAATTGGCCTACCATAACCCTTGCACTTTATTTGGAGAGCTTCTATAATTGTAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGGTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCCACACTCCATCAATATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGATCAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCA
  3   1   2       bld Gas5      in                    IMAGE:3749628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAGGAGAGCTTCTAAAATTGGAAAGGTANCTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGATGATATCTCCAGCTTGTCTCTCAAAATATTAAATGCAGGTGACTGGGTAAATTTCAGACCCTCTGTCTATTGATTCTTTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCCNCNNTCAAACACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTAGAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAA
  3   1   2       bld Ga10 5g3  in                    IMAGE:3558032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACATGGAAATGAAGATACTTAGGGTGCTAAAGTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAA
  3   1   2       bld Ooc3      in                    IMAGE:3437495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAAAAATTTAGGGTGATAAAGTTTGCAATTGGCCGACCCTTACCCCTGCATTTTCTTCGGAGAGCTTTTAAAATTGGAGAGGTAATTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGGACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTTTCTAAAAATTTTAAATGCAGGTGACTGGACCCCAACACTCCATCAATATATGGCTTACTTTGAAAAAGATTTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATTTTACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCCCGATTCCACAGCTGAGGTCAAATGTTGTTGTGGAAATGGCCCCCCCACTCA
  3   1   2       bld Ga18      in                      xlk166k23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGNCNGNCNNNACGTCNGnnnnnnnnnGnCnnnnnTCCGCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNCNNNATGTGCTTCTGTAAATAGTGTATTNTNNNTTAA
  3   1   2       bld Ga18      in                      xlk104f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNNNNNNCGNCCACGCGTCCCGGGCCGACCCTTNNCCCTGCACTTTCTTCGGAGAGCNNNNAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGNCCCGCCCACTCATGTGAANNNNNNGTGGCATTCCAATTGTGTATTGTNNNNNCATGTNCTTCTGTAAATAGTGTATTGTNTTTTTAA
  3   1   2       bld Ooc2      in                    IMAGE:3746329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGCAATTGGCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAA
  5   1   2       bld Unk4                                726_18N22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGACAATGCAATTATTTCAGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGGTAAGCTTTTTAGCCATTCAAGACAAGTTGTTAATTACTATATATGCATAACCCTTGCTTGAgggggggggAATGTGTGAAGCTTGCTTCCCATATTTCCATGGCAGTTAGTCTGGGTGGGTAAACTAGGTTAGCATGAAATAGATTACCTTGTGACCTAAATATAACTTGCTTTCCAGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATG
  3   1   2       bld Ga15      in                       XL460e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTAACATNGGATGTCCTCTAGGATTTACCAAAGAACATTTTTGTATTTGTAGGTAACTGNTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGGTAAGTTTCAGACCCTCTGTCTATTGATTCTTTGCTACTTGAAGTAGACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGGTAAGCTTTTTAGCCATTCAAGACAAGTTGTTAATTACTATATATGCATAACCCTTGCTTGAGGGGGGGGGAATGTGTGAAGCTTGCTTCCCATATTTCCATGGCAGTTAGTCTGGGTGGGTAAACTAGGTTAGCATGAAATAGATTACCTTGTGACCTAAATATAACTTGCTTTCCAGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAAATAGTGTAT
  5   1   2       bld Ga18      in                      xlk104f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATNNNNNCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATNNANNNNAAAA
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db24e11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCCTTACCCCTGCACTTTCTTCGGAGAGCTTCTANAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCCACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCAAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGAAAAA
  5   1   2       bld Ga18      in                      xlk166k23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCCTGCACTTTCTTCGGAGAGCTTCTAAAATTGGAGAGGTAACTGCTGAACAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATNNNNNCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGaaaaaaaaaa
  3   1   2       bld Neu7 5g3  in                         XL018a20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCATAGTTTAGCCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTT
  3   1   2       bld Egg3                            IMAGE:3378535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAATATTTGATGGAACTTGTGATGGTGGATTATGATATGGTACATTTCACGCCTTCCCAAATAGCAGCTGCTTCCTCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTT
  5   1   2       bld Ooc6                                Ooc6-2699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGCTTCTCCTGCTTGTCTCTCAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACACaaaaaaaaaaaaaaaaaaaaaaaaaaaagtccccccccccccc
  5   1   2       bld Egg1                               PBX0054D02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCTGCTTGTCTCTCAAAATCTTAAATGCAGGTGACTGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGATTC
  3   1   2       bld Neu7                                 XL048p10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCAAAATNTTAAATGCAGGTGACTGGGTAAGTTTCANACCCTNTGTCAATTGATTTTTTGCTACTTGAAGTANACAAAGGTCCACATGACAATGCAATTATTTCAGACCCCAACACTCCATCACTANATGGCTTACTTTGAAAAANATNTAGTCCCTGTTATGCAGCATATGGCCAANAACATCATCAAGGTGAACAAAGGACTAACCAAGCATNTGGTAAGCTTTTTAGCCATTCAANACAAGTTGTTAATTACTANATATGCATAACCCTTGCTTNAGGGGGGGGGGGGAAATGTGTGAAGCTTGCTTGCTTCCCATATTTCCATGGCAGTTAGTCTGGTGGGTAAACTAGGTTAGCATGAAATAGATTACCTTGTGACCTAAATATAACTTGCTTTCCAGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACTATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTGGCACCATGTGCTTCTGTAAATAGT
  5   1   2       bld Egg1                               PBX0046F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGGGGACCCCAACACTCCATCACTATATGGCTTACTCTGAAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTAATAAAGCTCATTTTAACATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGATTCGG
  5   1   2       bld Egg3      in                    IMAGE:3377166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGT
  3   1   2       bld Egg3      in                    IMAGE:3377166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGAGAAGATCTAGTCCCTGTTATGCAGCATATGGCCAAGAACATCATCAAGGTGAACAAAGGACTAACCAAGCATCTGACTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGACTACGTGGCATTCCAATTGTGTATTGTTGGCACCATGTGCTTCTGTAAATAGTGTATTGTGTTTTTAATGTTTTACTGGTTTTA
  3   1   2       bld Ga15                               XL468o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTTAAGAACAAGTATGCTAGCAGCAAACAAATGAAGATCAGCACGATTCCNCAGCTGNGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGNGAAGGATNTNCCNTGGCATTCCAATTGTGTATTGTTGGCA
  3   1   2       bld Ga18                              rxlk61o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACAAGTATNCTAGCAGCAAACAAATGAAGATCAGCACGATNNNACAGCTGAGGTCAGATGTTGTTGTGGAAATGGCCCGCCCACTCATGTGAAGGNCTACGTGGCATTCCAATTGTGTATTGTNNCNCCATGTGCTTCTGTAAATAGTGTATTGTNT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)