Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8823869.5                     427 PI      92         17     1480                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012767611 Xl3.1-IMAGE:7207205.5 - 113 ESTs
                                                                       -330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7207205.5                                                                                                                                                                                                                                                                                                                                           CAGATCTGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGCAAATGTGTGTAAGTGATTTATAAAGCTAAATGCA
                                                  Xl3.1-CHK-1012685508                                                                                                                                                                                                                                                                                                                                                 TGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                4     8     4    11    12    23    21    30    30    38    38    47    40    49    44    53    48    53    49    54    51    56    52    57    51    57    51    58    53    61    53    61    54    61    58    62    57    61    57    61    56    62    56    62    59    62    61    62    60    62    60    61    60    61    60    62    61    62    60    62    60    62    60    62    60    62    59    62    59    62    60    63    59    62    59    62    59    62    57    63    56    63    56    63    55    63    56    63    55    63    57    67    54    67    49    66    51    67    50    67    49    67    47    69    47    67    46    67    44    66    44    65    40    66    45    66    41    65    36    65    35    65    31    65    29    60    28    59    28    58    28    54    29    53    28    51    32    50    31    48    30    46    27    44    29    42    29    38    29    38    29    37    29    37    29    36    29    35    32    40    33    41    33    42    33    44    36    44    35    43    36    45    36    44    36    43    37    42    38    43    37    43    39    42    37    42    39    42    39    41    39    41    39    41    40    43    40    42    40    42    40    42    40    42    39    42    39    41    39    41    40    42    42    44    41    44    41    44    39    43    38    43    38    43    38    43    38    43    36    43    34    43    30    41    30    40    28    36    28    34    22    31    22    29    14    22    10    17    10    16    10    14    10    13    11    13    10    13     5     7     6     7     5     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                       -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A--A-
                                               BLH ATG      38     817                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN      38     280                                                                                                                                                                                                                                                                                                                                           
                                               BLH MPR       8     280                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR      38      58                                                                                                                                                                                                                                                                                                                                           
                                               CDS MIN      38      27                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI      15      27                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG      38       6                                                                                                                                                                                                                                                                                                                                           
  3   1   2       chi Tad2      in                    IMAGE:6871665.3p GGTGTTGTATAGTTAGATGAAAACACGGTCCTCCTCCCCCTTTTTATTTATAATTATAAGAAAGGGGGGGGGGGGGGGGGTGTGAATAAACAAAAGCACCCCCCCCCCCCCCCCCTCCCTTTATTGTGGTTTGTGCGCACCAAATAAATGTTTTATTTTGGTGTGTTTTTTTTTCTCCCCCACAAAAAAAGAAGAGAGGGGGGGGTGGCGCCTCTCTTTTTTTCTCCCCCATCATGAAGAGAAAAAAAACCCCACGGGGGGGTGGGGTGGGGGGCCCCACAAAAAAAAAATATAACCACCCCCCCCCCCGCGGGTGGTTTTTTTTTTTTTAAAAAAGAAAAAAATTTCTCCTCCCCCCCCCCGGGAGGGAAAAAAAAGAATCCTCCCCCCCCCTTTTTTTTTGTGGGGGGCGCCACACACCCCCCGGGTTTTTTTTTCCCCCCTTCTTTGGGGGAGAGAGAGGGGGGGGCCCCCCCCCATTGTGCGCCAAATTTTATTGGTGGGGGGAAAAAAAAAAGAAAGGGGGCCCTCCGCGGGGAAAAGACACAAAAAATATTTTTGTTTTTTCCCCCCACAGGGGTCGGGGGTGTTTTATTTCGGGGGGGGGTGGGGGGTTTTTTTAAAAAAAAAGTATAAATTTTTTTTCCTCTTCCGGCCCAAGGGGGCAAATGGGTTTTTTTCCCCCCCCTCTTGGGGGGGGTTCTCATGCCAATTTTTTAATTAGACCCAGGGCCCCCCCGGGACCCAAAGCCCAAGGGAAGGGGGATAAAGGACTTTGGGTGGGGTGTTTTAAGATTTTCATTTGCAGACAAGGGACGTTCCTTAGTGGGGCGAGAGGATCCACACTGGGCTGATATAACTCTTTACATGTTCTCTCCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGAGACAAGATGGCACAGTTTGACGCCAAGAAGTTGCCGAGGGCGGCTCAAAAAGGCGGCCNNGGNGCCGNANCGCCGGGGTGGnnnnnnnnnnCCCCCCGCAGGGTGCGAACACCGCGTGAGGCCCAAACGC
  5   1   0       chi Emb4                            IMAGE:5515303.5p                                                                                                                                                                   CACGAGGTGGTTTGCGACCTGTGTGAATCAGCCAGAGGAGAGAACATGCAAGAGTTACTATCAGCCAGTGTGATCCTCTCGCCCACTAGGAACGTCCTTGTCTGCAGATGAGAATCTAAAACACCCAGCACAGTCTTTATCTCTTCCTTGGCTTGTTCTGTGGCCTGCTTATTAAACTGCATGATCCCCAGAGTGGGAAAAACCCATGCGCTGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAATAAATTCCCCTTGGGCAAGGTACCGGGATggggggggggggACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGTTCATTATGTGGCTAATGATGAGCTCCGAGGTATGCAATAATCGTTTACACCAAGCTCATGTCATTCAGAGGGTCGGCTCCTCAAACAGTCTCTTTGCGTTCCTTGTCCATCCGTGTCTTAGAATGTTTCTGTGTTCTTATGAGATGCCTAGTGAGGTGTAGGAAATGAACGATAGAGAAGATAGTTATTAGTGTCGCCTTCGGATATAGCGAGATTTAAATGTACATACTTTTATTTTTAATATGTACGTTAGTATAATTTCCCTATTGGAAATTGGTTTTTTATATCCGGTAGGTATTGTGACACATAGGAATTTATATATTT
  5   1   2       chi Tail                            IMAGE:8544175.5p                                                                                                                                                                              GTGAAGATGGCCGGCGGGGTAAGTGGAGAACAGGTCGGAGAGAATCCATCCACATCCCAAGGGCTTTTGCCTCGCCCGGGTTATAGTGCGGGTCAGTGGGATGTAGCGGCCTCTCTGCTCTCCGGGAAACCCTTCATCTCCTGCTTTACGTCTGTCACTGACGAGTAATAATGGCAGCGGGAATAGTGCGCGGCTTTACCCGGAACTAAAGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATACACTGGCTGATATACTCTTACTGTCTCTCCTGTGGTCTATAAGCAGTCTGGAACATCTTCGCCCGCCTATGGACGTCACAGTGGTTGGACTGGTGATCACAGAGTCTGTGTGTGGAGATGACCTGTGACAAGCCATTGATGCAATTGCTAGGACCAA
  5   1   2       bld Int2 5g                         IMAGE:8530730.5p                                                                                                                                                                                     AGCGTTTTCTCTCACACAAACCTGTCGTATCGCTCATGTATTTGCCCCATAAACTTGTCTGTACGTCTCACCGCACGTTACGCTCTGGTCGTACAAACGCTTCAGTTTTACGACAGCCGCTAGTGTGTTTTCGGCAGCTATAATACGTCACAGATCTGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGCCTCTATAG
  3   1   2       bld Te2N                            IMAGE:7202949.3p                                                                                                                                                                                                                     AAACAATGACTACATGATTGCGAGGTTTTCCCACTGTGATGTCAGATGCAATACTGTCGAGTTCCGCACGTACGTTGTGTACACGCTCAGTTTAGCAGCGCTAGGTGTTTCGCAGCTATATACGTCCAGTCTGAAGCGCGCTCCTCCTTCTGCTCGCGTGAGATGGCCGGCGNACTCTGTACACGTACCCTGATAATGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGGACTCCCAGAAGGAACACAAGTTN
  5   1   2       bld Int2 5g                         IMAGE:8821005.5p                                                                                                                                                                                                                                                                                                                             CCGCGCCCTGACTACGGGCAATATGccccccccTACAAATTCGTCCCCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCT
  5   1   2       bld DMZ  5g3  in                         xl320d14.5p                                                                                                                                                                                                                                                                                                                                  ATTACGTCACAGATCTGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCA
  5   1   2       bld DMZ  5g3  in                         xl301a24.5p                                                                                                                                                                                                                                                                                                                                  ATTACGTCACAGATCTGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGA
  5   1   2       bld DMZ  5g                              xl224b04.5p                                                                                                                                                                                                                                                                                                                                         CACAGATCTGAAAGCGCGGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTT
  5   1   2       bld Ga18 5g                            xlk61f09ex.5p                                                                                                                                                                                                                                                                                                                                               AGANCTGAANNCNNNNTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCNGNNNNTTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGNNCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGNNTTGTGANCTGTGTGAATCAGCCAGNGTTCCGTGCTGTGTTGGGAGAAGNGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCNAGAAGTTTGCCGAGGNGCAGCCCAAAAAAGAGNNTCCCAGNAAGAG
  5   1   2       bld Tad1 5g3  in                    IMAGE:6880576.5p                                                                                                                                                                                                                                                                                                                                                      GGGGGCTCCTCCCTTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAAGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATTAGCAGGTCCTGGGACCATCTTTTCGCCAGCCTTATGGTAATGTCACCGAGGTGGTTTGTGACTTGGGTGAATCAACCCAGATTTCCGTGCTGTGTTGGGAAGAAATGTAACCTTTTTGACAAGAAGGCACAAATTTTGATTGCCCAAAAAGGTTTGCCGAAGGTGCAACCCCCaaaaaaaaaaaCTTCCCCAAGAAATGAGAAAACCACCGCAAAGGGGGCCCCaaaaaaaagaaaaaggggggggaaaaaaaagaaaaGGGCCCCA
  5   1   2       bld Ga18 5g                           xlk140e01ex.5p                                                                                                                                                                                                                                                                                                                                                      AAAGCGCNNTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCNGNNNNTTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGNGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTNCCGAGGTNCAGCCCAAAAAAGAGANTCCCAAGAAAGAGAAANNAGCAAANGANNCaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL448b04ex.5p                                                                                                                                                                                                                                                                                                                                                        CTCCGCGGACGCGCTGGGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGA
  5   1   2       bld Ga14 5g                             Ga14-p2a1.5p                                                                                                                                                                                                                                                                                                                                                          GGCTCCTCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTT
  5   1   2       chi Te1                             IMAGE:6929284.5p                                                                                                                                                                                                                                                                                                                                                              GGGCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGGCAGCGCATGGGTTTTTTCCCACTCTGGGGGATCCTGCAGTTTTAATAAGCCGGGCCACAGAAACAAGCCCAAGGAAAAAATAAAAGAACTggggctggggggggTTTTAAAAATTCCCCATCCTGCAAGAAAAAAAGGAACCTTTCCCCTAATTGGGGGCCCAAAAAGGGATTCCCCCCCTGGGGCCGTGaaaaaaaaaaaacctcctttaaaaagggggttctcccccccccccgggggggggggCCCCTCTTTTAAAAAA
  5   1   2       bld Tad2 5g                         IMAGE:6935703.5p                                                                                                                                                                                                                                                                                                                                                              GGGCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGCCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAAGACGTTCCTTGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACCAAGGTGGTTTGTGACCTGTGTGAATCACCCAGAGTTCCGTGCTGTGTTGGGAAAAATTGAACCTTTTTGAAAAGAATGCACAATTTTGAAGCCCAAAAATTTTGCCCAGGTGCACCCCAAAAAAAGAAACTTCCCAAGGAAAGAAGAAACCC
  5   1   2       bld Tad1 5g                         IMAGE:6939459.5p                                                                                                                                                                                                                                                                                                                                                              GGGCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCCGCCCTTAGGGTAATGTCACGAGGTGGTTTGGTGAACCGGTGTGAATCAGCCCAAAGTTCCGTGCTGTTGTTTGGGAAAAAGTGAAACCTTTTGTGACAAGATGGGCACAAGTTTGGAATGCCCAAAAAGTTTTGGCCGAAGGTGCCACCCCCCAAAAAAA
  5   1   2       bld Tad1 5g                         IMAGE:6938533.5p                                                                                                                                                                                                                                                                                                                                                              GGGCCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGGTTTGTGACCCTGTGTGAATCAGCCAGAGTTCCCTGGCTGTGTTTGGGAGAAGTGAAAGCTTTTTTGACCAGATGGCACAATTTTGAATGCAAAGAAGTTTGCCCAAGGGTGCCACCCCaaaaaaaaGTAGACTTCCCAAGAAAA
  5   1   2       bld Tad2      in                    IMAGE:6871665.5p                                                                                                                                                                                                                                                                                                                                                                 CCCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGNGACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCCGTGCTGTGTTGGGGAGAAAGTGAAGCTTTGNTTGACAGATGGGCACAGTTTGAATGCCCAGAAAGTTTTGCCAAGGTGGCCAcccccaaaaaagagaactccccccagaaagaaaaaaacccgcccaaaGGAAGCCCCTN
  5   1   2       bld Brn1 5g                         IMAGE:6956011.5p                                                                                                                                                                                                                                                                                                                                                                 GGCTGGACCGGTCCGGATTCTCCGGATGGCGGGACTCTGTACACGTATCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGTCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaaggaaaagaagaaggcaacaccccgctcctgcccccggccccccGAGGAAGACCTGGATGAAATCTGAAAAAGGCTTTAGCCTGCAGAAGCCTAAATCAAAGGGACCC
  5   1   2       bld Eye1 5g                         IMAGE:6948563.5p                                                                                                                                                                                                                                                                                                                                                                 CCCGGGATCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGANTAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCACCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGGGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAAGGGCACCCCAAAaaagagactcccaagaaagaaaaaccggcaaaggagccacaaaaaaagaaaaggagggaaaaggaaaaaggGAACACCCGCTTTCCTGCCCCCGGGCCCCCGGAGAGGAGGAACGTGGGAAGGAAATCTTGAAAACACGGCTTTTTACCCTGCGATAACCCTCAAAATCACAAAGGAACCCCCGTTTGACCACACTATATTACCTCTACAAAAGACTCGCCTCAGCAAGCCAGGGCAATGGAGAGTGTTTTAGAGAGGGGAGTAACAATATGTTCGCCGAGTGGGAGAAAGAGACCACTCCCTCATGAATCTTATGTGTAAAATCCTACTCTAC
  5   1   2       bld Egg3 5g                         IMAGE:6324225.5p                                                                                                                                                                                                                                                                                                                                                                  TTCCCGGGGCTCGCGTGAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCCTGGAAACATCTTTCCGCCAGCCCTTATGGTAATGTCCCCGAGGTGGGTTTGTGAACCTTGGGGGAAATCAACCCAAAAATTCCCGTGGCTGGGGTTTGGGGAAAAAATGGAAACCTTTTGTGAACAAAAATGGGCCCCCGTTTTGATTGGCCCaaaaaaaatttttgccccaagggggggcaaccccccccnaaaaaagggggatctctccccccgggaaaggggggaaaacccccccccccaaggggggggcccccccaccatatggaaaaaaggggggggggaaaaaaaaaaaaaaaaaaggggggcttaccccccccccGGTA
  5   1   2       bld Tad2                            IMAGE:6876202.5p                                                                                                                                                                                                                                                                                                                                                                  CCTTTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCCTCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAAACAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACCAGGAACGTTCTAGGGGGCGAGAAGATCACCCTGGGTGAAATAACTCCTAACTGTTCTCCCCCGGGGGTTCTATAAGCCAGGCCCTGGGAACCTTCTTTTCCGCCAGCCTTATTGGGAATGGCCCCAAGGGGGGTTGGGGACCCGTGGGGAATTCGCCCAAAATTCCCTGCTTTGGGTTGGGAAAAAAGGAAAACTTTTTGGACCAAAATGGCCCCAATTTTGTATGGCCACAAAAATTTTTCCCCGAGGGGCCCCCCCCCaaaaaaaaaaatcccccccccagaagaaaaaaaccccccccccgggggggcccccaaacaaaaaaaaaggggggggaaaaaCC
  5   1   2       chi Tad1                            IMAGE:6939823.5p                                                                                                                                                                                                                                                                                                                                                                  GGGGTCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGGAAACCATCTTTCCGCCCAGCCTTTAGGTTAATGTCACGAGGTGGGTTTGTGACCTGTGTGAAACAGCCAGAGTTCCCTTGCTGTGGTTGGGAGAAAGTGAAGCCTTTGTGACAAAGATGGCACAGTTTTGGATGGTGTTTTCTGCCCAAGGTTTAAAATTTTTTTAAATTACCCCTATAGCCCCAAAAAATTTTGGCCAAAGGTGCCAGCCCCaaaaaaaaaaaaTTCCCCCAGGAAAGGAAAAAACCCG
  5   1   2       bld Lmb1 5g                         IMAGE:8535598.5p                                                                                                                                                                                                                                                                                                                                                                      tCTGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGCCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAGTGAAAGCTTGTGACAGATGGCACAGTTGATGCCAGAAAGTTGCGAGTGCAGCCAAAAAGAACTCCCagaagagaaccgcaagagcaaaaagaaagagaaagagagCACCCGCTCTGCCCGCCCGAGAGACTGATGACGAAAGCTTACCCA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048075.5p                                                                                                                                                                                                                                                                                                                                                                          CTAGTTCCGGACGCCCGGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCTAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGATCTCCGACGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAACAG
  5   1   2      seed Ga15 5g                            XL458a17ex.5p                                                                                                                                                                                                                                                                                                                                                                          CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCA
  5   1   2       bld Te2  5g                         IMAGE:7208784.5p                                                                                                                                                                                                                                                                                                                                                                              CGTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAA
  5   1   2       bld Eye1 5g                         IMAGE:6958555.5p                                                                                                                                                                                                                                                                                                                                                                               GTGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCccaaaaaagagactcccaagaaagagaaaccagcataggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCCGCTCCTGCCCCGGCCCCCCGAGGATGAACCNTGGATGAAATCTGAAGAAAGGCTT
  5   1   2       bld Tail 5g3  in                    IMAGE:8543292.5p                                                                                                                                                                                                                                                                                                                                                                               GTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTNGCGAGGTGCAGCCCAAAAAAGAGACTCCAGAAAGAGAAACAGCAAGGAGCCAAAAAGAAAGGAGGAAAGAGAAGCACACCGCTCTGCCCGGCCCGAGAGACTGATGATCGANAGCTTACTGAAGCTATCAAGACGTAGCCT
  5   1   2       bld Int2 5g                         IMAGE:8527679.5p                                                                                                                                                                                                                                                                                                                                                                               GTGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAGAGACTCCcagaaagagaaacagcaaagagccaaaaagannagaggaaagaagaagCACACCGCTCTGCCCGCCCCGAGATGACTGATGATCTGAGAGCTTAGCGCAAGCTATCAAGACGT
  5   1   2       bld Te2N 5g                         IMAGE:7204396.5p                                                                                                                                                                                                                                                                                                                                                                                TGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaagaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACTTGGATGAATCTGAGAAAGGCTTTAGCTGCAGAGGCCTAAATCAAAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980486.5p                                                                                                                                                                                                                                                                                                                                                                                TGAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCATTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGcagcccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaaggaaaaggaggaaaagaagAGTC
  5   1   2       bld DMZ  5g3  in                         xl275g24.5p                                                                                                                                                                                                                                                                                                                                                                                TGAAGATGGCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070057.5p                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGGCCGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCCGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAGAGACTCCCCAGAAAGAGAAACCAGCAAAGGAGCCAAAAAA
  5   1   2       bld Emb4                            IMAGE:5514809.5p                                                                                                                                                                                                                                                                                                                                                                                       CCCACGCGTCCGCTGTACACGTACCCTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCagcccaaaaaagagactcccaagaaagagaaaccagcaaaagagccaaaaaagaaaaagaggaaaagaagaagCACACCCGCTCCTGCCCCGCCCCCGAGGATGACTG
  5   1   2       bld Em10                            IMAGE:7980189.5p                                                                                                                                                                                                                                                                                                                                                                                        GCCGGCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGTGCAGCccaaaaagagactcccnagaagagaaacagcaaggagcaaaaaagaaaggagaaagagagGCACCCCGCTCTGCCCGGCCCCAGAGACTGATAATCGAGAGCTTACGCAAGCTAACAAGACCGATGCCTTCTAAGTCCTAATGAGA
  5   1   2       bld Ga12                                 XL198m05.5p                                                                                                                                                                                                                                                                                                                                                                                         AGGGCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGA
  5   1   2       bld Tbd7      in                         XL068e02.5p                                                                                                                                                                                                                                                                                                                                                                                            GCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCCTGTGTGAATCAGCCCAGAGTTCCGTGCTGTGTTGGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAA
  5   1   2       bld Te2N                            IMAGE:7206036.5p                                                                                                                                                                                                                                                                                                                                                                                            GCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaaNGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCTAAAATCAAAGGACCCGTATGCACATTTACCTTAAAAGTTCCTTTTTAATGGAATGAGTTTTTAAGAGGGAAATAT
  5   1   2       bld Ga15      in                       XL421m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                            GCGGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAANAAGTTTGCCGAGGTGCAGCCCAA
  5   1   2       bld Int2                            IMAGE:8528227.5p                                                                                                                                                                                                                                                                                                                                                                                            GCGGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGTCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCagcccaaaaaagagactcccaagaaagagaaacagcaaaggagccaaaaaaagaaaggaagaaagaagaagGC
  5   1   2       bld Ga18      in                        xlk2k11ex.5p                                                                                                                                                                                                                                                                                                                                                                                             CNGCGGACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGNCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGNNNATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTNCCGAGGTGCAGCCcaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaNGANGNAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGNCCCCGANG
  5   1   2       bld Ga12      in                         XL208l06.5p                                                                                                                                                                                                                                                                                                                                                                                              GGGACTCTGTACACGTACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGAGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCA
  5   1   2       chi Em10                            IMAGE:8318642.5p                                                                                                                                                                                                                                                                                                                                                                                                TGGACTCTGTAACGTACCCTGATCCCTTTAGGGCTACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCATTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCATTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGATAATGACTTTCCTAGTGTGCGAGAGGATCAACTGGCTGATATAAATCTTTCATGTTCTCTCCTGTGGTTCTATAAGCAGGTCCTGGAATCATCTTTCTCCCTGCCATATGGTAATGTCACGAGGTGGTTTTGTGACCTGTGTGAATCTCTCAGAGTTCTTTGCTGAGTTGGGAAGAATTGAACATTTGAGAATAGTTGGCATATTCGATACCAATGAGTTTGCTGAGGTGCATCTCTAATAAACATCTCA
  5   1   2       bld Egg2      in                    IMAGE:5162067.5p                                                                                                                                                                                                                                                                                                                                                                                                 ACTCTGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGGTTGGACTAACAAATAACACACCGGAGCTCCTAAAGAAATTCCGCTTGGGCAAGGTACCGGCATTTGAGGACAACAACGGCTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAA
  5   1   2       bld Em10      out                   IMAGE:7982012.5p                                                                                                                                                                                                                                                                                                                                                                                                     TGTACACGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAGTTTGCCGGGTGCAGCCCAAAAGAGACTCCaagaagagaaaccgcaaggagctaaaaagataagagaaaagagaagCACACCGCTCTGCCCGCCCCGAGAGAATGATGAT
  5   1   2       bld Sp1                             IMAGE:4175070.5p                                                                                                                                                                                                                                                                                                                                                                                                         CACGTACCCTGATAACTGGATGGCATACAAACCTCTAATTGGTGGTCAGTATTGCCGTTTCCCCATGAAGGTTGACTCCTCTCCTGCGCAATTACAGTTTGGACTATCAAATAATACACCGGATTTCCTAAAAAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTATTTGTCTTTATGAGAGCAGCGTCATGGCTCATTATGTC
  5   1   2       bld Spl                             IMAGE:8462316.5p                                                                                                                                                                                                                                                                                                                                                                                                          CCGTACCCCGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGTCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGANCAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAaaaagagactcccagaaagagaaccagcaaggagccaaaaaagaaagaggaaagagaaGCACACCGCTCTGCCCCGCCCGAGAGACTGATGATCGAAAGCTACTGAAGCTATCAAGACGTTGCCATACTAAGTCTTTATGAGAGTAAGATTTCAGAACCTGCG
  5   1   2       bld Te2N      in                    IMAGE:7765682.5p                                                                                                                                                                                                                                                                                                                                                                                                                     ATAACTGGAGGGCATACAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGcccaaaaagagactccaagaaagagaaccagcaaaggaccaaaaaagaaaggaggaaaGAGAAGGCAC
  5   1   2       bld Ov1                    IMAGE:6318893-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACCGCGTCCGCAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAAATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAA
  5   1   2       chi Emb9      in                    IMAGE:7974030.5p                                                                                                                                                                                                                                                                                                                                                                                                                        TAGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCATACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTACTGGGGATCATGCAGTTTAATAAGCAGGCCACATAACAAGCTAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTATATTCTCATCTGCAGACTAGGACGTTCCTTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTTCATATGCAGGTTCTGGAACTATCATTCCTCCATCCTTATAGTAATGTCACAATGTGGCTTGTGACCTGTGTGAATCTACACGATTTCAAGCTGTGTTGGGATATATCAAGCTTTTTGACATATGGATAATTTGTTCTTAGAAATTTCCAGATGTCTACTCAAAAAGATATCTCAGATATAATACATCAACGACCTATCATTAATGTATATATATATGCTTCCTCTCTTCCTCGTCCTAGATATTGAGATTTAAAGTTAACTAACTAATCAAGACTTGCCTTTCTAATCTTTTAATATATTACTGATTCATCAATCCATTCTCTTTC
  5   1   2       bld Ov1                             IMAGE:6318893.5p                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGCAAGCCCCTCATTGCTGCTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAAATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCagcccaaaaaaagagactcccaaganagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaaggCAACACCCNGCTCCTGCCCCGGNCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTANATCAAAGGACCCGTATGCACATCTACCTAAAAGGTCCTTATAATGGATGAGTTTTAGAGGAAATATTCCCATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACCTTGAAAAAGGAAAGCTGGTCCATCTTGGTACGC
  5   1   2       bld Ga15                               XL475g15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGTATTCCCGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTGCATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAANATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGcccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaaggCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGG
  5   1   2       bld Skin      in                    IMAGE:8641271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGcagcccaaaaaagagactccccagaaagagaaaccagcaaaggagccaaaaaaagaaaggaggaaaagaagaaggaaCACCCGCTCCTGCCCGGCCCCCGAGATGACTGGATGATCTGAGAAGCTTAGCGCAGAGCTAATCAAAGACCGTAGCCATTACTAAAGTTCTTTATATGAGAGTTAGAGAATATCATG
  5   1   2       bld Te2       in                    IMAGE:7208608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTCCCCATCAAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCACACCCGCTCCTGCCCGGCCCCCGAGGATGACCTGGATGATCTGAGAAGCTTAGCTGAGACCTAATCAAGGACCGTAGCCATTACTA
  5   1   2       bld FaBN      in                    IMAGE:8076258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGTCGCCTCCTCTCCTCCCGAATTCCAGTTTGGACTAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCcaagaaagagaaaccagncaaggagcccaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGNATGAATCTGAGAAGGCTTAGCTGCAGAGCCCTAAATCAAGGACCGTATGCCATTTACTAAAGT
  5   1   2       bld Ga15                               XL511k24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCATTTTGCATGTATATAGTATGTATGTATGGNANANGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCNAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCANACAGTCACGTCNTCCCTCCGGCCANCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGNAATGTCACGAGGNGGTTTGTGACCTGTGTGAATCA
  5   1   2       bld Int2                            IMAGE:8529790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTGGACTAACAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCCTAATCAAGGACCCGTATGCACATCTACCTAAAGTTCTTTATATGGATGAGTTTAGAGGAATATCC
  5   1   2       bld Ooc1      in                     Ooc1-db33f06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGAGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTGCCTGGTAAAGCGCCCGCAAAGTTGTCGCGTTTGTTTGTGTTTTCCCGCACGGAGCCC
  5   1   2       bld Sp1       in                    IMAGE:4174710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACAAATAAGACACCGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGTCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCC
  5   1   2       bld Ga15      in                       XL446o21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGAGTTCCTAAAGAAATTCCCCTTGGGCAAGGTACCGGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGTAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTANCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGNAAGACA
  5   1   2       bld Lmb1                            IMAGE:8536248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGAGCATCGATTAAAATCGTCCCCGCCATTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAACGTCACGAGGTGGTTTGTGACTTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTTCCGAGGTGCAGCCCAAAAAAGAGACTcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAAGCTTTAGCAGCAGAGCCTAAATCCAAGGACCCGTATGCACATCTACCTAAAGTTCCTTTNATATGGATGAGTTTAGAGGAATATNCNNATGAGACACCTGACTGTAGCTCTGCCTATTCTNGAGCATTTGAAAAGAAGCTGTCATCTGTAGCAGATATAATTTCCGAGACTGACCACTTNATGACTGCACTATAAGTAGTCACGTTAAACTGCTAATGCTCCATGCCTGTCGACAATAAGCATCTGCTGGGTC
  5   1   2       bld Tad1      in                    IMAGE:6881253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGCTCATTATGTGGCTAATGATGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAACCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCanaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaagaaaagaagaaagCAACACCCGCTCCTGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTAAGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAAGAAATATTCCAATGGAAGACACCCTGACTGTAGCTCTGCCTTTATTTCTGGGAGCACTTTGAAAAAGAAGGCTGGTTCCATCTGGGTACGCANAAAAATAAATTTTCCGGAGGGAG
  5   1   2       bld Tad2                            IMAGE:6935495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAGCTCCGAGGAAGCAATAATCGTTTACACCAAGCTCAGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGGCTcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaatgaagaaggCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGGAGCACCTTTGAAAAAGGAAGGCTGGGTCCATCTGGGTACGCAAAAATATAAATTTTCCCCGAGGGAGCCTG
  5   1   2       bld Tad1                            IMAGE:6938524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGTCATTCAGTGGGTCGGCTTCTCAGACAGTCACGTCGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGcagcccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAAGCTGGTCCCATCTGGTACGGCAGAATATTAAATTTTCCCGAAGGAGCTGGACACAAAAG
  5   1   2       bld Ga15                               XL481g21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTTTAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCANAATATAAATTTCCCGAGGAGCTGACACNAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTANATAAACTGCGTAAAACTGCCTTCNCCAGTGTCATCTTGTTCGGG
  5   1   2       bld Te2       in                    IMAGE:7207205.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCCACAGAACAAGCCAAGGAAGAGATAAAGACTGTGCTGGGTGTTTTAGATTGTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGcagcccaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAACTGCCTTCGCAGTGTCATCTTGTCGGGACCAACATACAGCACATCTCTGGCGTGTGGTGTTCGGGGCATGACTTGCATTACCTCCTGAGACTGCAGATGACTCGATCTACACTGAGAAGCTGAAGGACGTAG
  5   1   2       bld Ga15                               XL445c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAGATTCTCATCTGCAGACAAGGACGTTCCTAGTGGGCGAGAGGATCACACTGGCTGATATAACTCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCaaaaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaaggCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTANATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGGTGTTCCGGGGCCATGAC
  3   1   2       bld Tail 5g3  in                    IMAGE:8543292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATTCACACCTGGCTCGAATTATAAGTCTTTACAGTTTCTTTCTGTGGCTAAGGCAGTCCTGGACCATCTCGCAGCTATGTAATGTCACGAGTGTTGTGACTGTGTGAATCAGCAGAGTCCGTGCTGTGTGGAGAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAAACAGAAAAAATTCA
  3   1   2       bld Te2       in                    IMAGE:7208608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATTTTTTTCTTCCGGGGGTTTAATAAGCAAGTTCCTGGAAACCTTCTTTCCGCCCAGCCTTAATGTAATGTCACGAAGTGTTTGGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTGGGGAGAAGTGAAGCTTNGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTAACAAGACTGCAAACGGAAAAATAAAAAAAA
  5   1   2       bld Te2N      in                    IMAGE:7764992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTACATGTTCTCTCCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAaaaagagactcccaagaaagagaaaccagcaaaggagccaaaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACGGTGAAGAGTGCAAAACGATGGTCAGGAATACTTTGCCTGGGAGGGAGAATTCAGCACG
  3   1   2       bld Tad1      in                    IMAGE:6881253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTAACAGTTTCTCTCCTGTGGCTCTATAACCCAGGTCCTGAAACCATCTTTCCCGCCAGCCTTATGGTAATGTCACGAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCCGTGCTGTGTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCNGGTTTCAC
  3   1   2       bld FaB  5g3  in                    IMAGE:8070057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATGAGTTCCTCTGGAACCCATTGTTTCCGCCCAGCCTTTATGGTAAATGTCTACGAGGTTGGTTGTGAACCCCTGTGAATTCAGCCAGAAGTTCCGTGCTGGGTTGGGAGAAAGTGAAAGCCTTTGTGACAAGATGGCACCATTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCCAAAAAAGAGACTCCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAAAGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTATGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTAACAAGACCCAAACGCCACCTCCACCCCCGACG
  3   1   2       bld Tad1 5g3  in                    IMAGE:6880576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTGTTCCATGGAAGGGTGGGTTTTTGTTGAACCTTGTTGGGGAATTCCAGCCCCAGGAGTTTCCCGTTGCTTGTGTTTGGGAGAAAGTTGAAGCTTTTTGGGACAAAGATGGGCACCGTTTTGATGCCCAAGAAGTTTTGCCGAGGTGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCATTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCC
  3   1   2       bld Thy                             IMAGE:8546586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGTTTAGCGTCGAACATCTCGCAGCTAGGTATTCCGAGTGTTGGACTGGGATCGCCGAGTCCTGCTTGTGGAGAATGAGCTTGGACAGATGCACAGTTGAGCCAGAAGTTGCGAGGTGCAGCCAAAAAGAGACTCCAAGAAGAGAATCAGCAAAGAGCAAAAAAAGAAAAGGAGAAAAGAAGAAGGCAACACCCGCTCTTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGAAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCGGAGC
  3   1   2       bld Ga18      in                        xlk2k11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNGTTTNTGACCTGTGTGANTCAGCNAGAGTTCCGTGCTNTGTTGGNAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGNCGAGGTGCAGNCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAnnCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCNCTCCTNNCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTNNTNTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATNNNNNNGTAAAACNNCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGNNNNAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGNTTTCACATCTGTTCCANCNTCCAGNC
  3   1   2       bld Emb9      in                    IMAGE:7974030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTGAATACAGCCAGAAGTTCCGTGCTGTGTTTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTGATGCCAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAGGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCATGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGGAAAAATTAAAAAAAA
  3   1   2       bld FaBN      in                    IMAGE:8076258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGTGATCAGCCAGAGTTCGTGCGGGTGGGAGAAGTGAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAGAGNAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACTACCTGGAGAAAGCTGGAGAGTGACAGTGAGTGAGTGCAGAACGATGGTCAATGGATATACTTTGCCTGGGAGGGAGAATTCAAGCACGTTGGGCAAGGCCTTTAACCAGGGCAAGATTTTCAAATTGAGGAGAGACGATCTTGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCC
  3   1   2       bld Ga15      in                       XL421m18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTAAAGCTTTGTGACAAGATGGCACAGTTTGATNCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGA
  3   1   2       bld Em10 5g3  in                    IMAGE:7980486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGATAAACTTTTTGACAGTTGACCCATTTGAGCCTGAGTTTACGGGAGTCCACCCCAAAAGGAGCTCCCCGAGAAGGGACCGGGCAAGGGCCTATATAGTATAGGAGGAAAGAGAGTGATAACCCCGGTTCTGCCCGGCCCCTGAAGTGAACTTGATAGATTTGAAAAAGCTTAGCCGCAGAGCCTAATCAAAGGGCCCGTATGCAACATTACCTAAAGTTCCTTTATAATGGAAGAGTTTAAGAGGAAATATCCCAATGAAGACACCCTGAATGGTAGCTCTGCCTTTATTTCTGGGAGCACTTTGAAAAAGAAAGGCTGGTCCATCTGGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGGTATGTTCCAGCGTTTAGATAAAACTGCGTAAAACTGCCCTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCTTGGTCCCCGTAAGATACGCGAGTCTGGTTTCACATCTGCTCCAACATCCAGAGCCTTTAATTAACAAGACTGCAAACGGAAAATAAGT
  3   1   2       bld Te2       in                    IMAGE:7207205.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGTTGNATGCCAAGAAGTTTGCCGAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTAACAAGACTGCAAACGGAAAATAAAAA
  3   1   2       bld Te2N      in                    IMAGE:7764992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGCTTATCACGATCTGCGTGGAAGAGCTGGCAGTGCCATTGACCAGAGTGCGGGTCGCCAAAAGGCTCCAAGAAGGACCCGCAAGGGCCAAAAAGAAAGAGAAAGAAGAGGCACACCGCTCTGCCCGCCCCCGAGGTGAACGGATGATCTGAGAAAGCTTAGCCGCAGAGCCAAATCAAAGGACCCGTATGCACATTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTTTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAATAAAAAAAACTGAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12      in                         XL208l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGTGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACGCAAACG
  5  -1   2       bld Em10                            IMAGE:7980825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGTGCAGCCCaaaagagacttcccaagaagagaaccagcaaaggagccaaaaaagaaaaggagaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCTAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCTTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaataaaaaaaactgaaat
  3   1   2       bld Skin      in                    IMAGE:8641271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAAAAAGAGACTCCCAGAAAGAGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTG
  3   1   2       bld Te2N      in                    IMAGE:7765682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGCAGCCAAAAAGGGCTCCCAGAAGAGAAACAGCAAAGGGCCAAAAAAAGAAAAGAGGAAAAGAAGAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGACCTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATTTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTTTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATTTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7      in                         XL068e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAACCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATGCCAGAGCCTTTTAATTTAACAA
  3   1   2       bld Ga15 5g3  in                       XL448b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGATGCGTCGTTATGTATTTGGTGCTTACGATTTATACACACAAAT
  5   1   2       bld Lmb2                            IMAGE:8639020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        aaaaaagaaaaggaggaaaagaagaagGCAACACCCGCTCCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAGGCTTTAGCTGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAGACTGCAAACGGGAAATaaaaaaactgaaatgaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld DMZ  5g3  in                         xl275g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCCCCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACCGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTT
  3   1   2       bld DMZ  5g3  in                         xl301a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGCCCCCGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTATACAAGAAAATG
  3   1   2       bld DMZ  5g3  in                         xl320d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGATGAACTGGATGAATCTGAGAAAGCTTTAGCCGCAGAGCCTAAATCAAAGGACCCGTATGCACATTTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATG
  5  -1   2       bld EggS                            IMAGE:4785712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATTTCCCCCGCAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTTCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTCTGGGAGCACTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGAAAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaa
  5   1   2       bld Ga15                               XL481l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATATTCCAATGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaaaaaaaaa
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAGACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGA
  3   1   2       bld Li1                             IMAGE:5129403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACCCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTGAAAAAGAAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATG
  5   1   2       bld Egg1                               PBX0135C02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTTCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGAGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGAAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCaaacggaaaataaaaaaaactgaaatgaaaaaCATTGTGTCGGCATCAAAGTTTTCTAAATGACGCGTCGTTATG
  5   1   2       bld Ga15      in                       XL506d09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaatgaaaaaCATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL506d09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGACTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATG
  3   1   2       bld Ga15      in                       XL446o21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNTGCCTTATTTCTGGGAGCACTTTGAAAANGAAGGNTGGTCCATCTGGTACGCAGAATATAAATTTCCNGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTACCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGA
  3   1   2       bld Ooc1      in                     Ooc1-db33f06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGCAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg2      in                    IMAGE:5162067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGAGCACTTTGAAAAGGAAGGCTGGTCCATCTGGTACGCAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACACACAAATGTGTGTAAGTGATTTATAAAG
  3   1   2       bld Gas8                            IMAGE:3516305.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCACTTCGAAAAGGAAGCATGGTCCATCTGGTAGGCAGAATATCAATTTCCCGAGGAGCTGCCACAAACTTTTATGAGCTGCGACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGATGCGTCGTTATGTATTTGGTGCTTACGATTTATACACACAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCAAAAAAAAAAAAAAA
  3   1   2       bld Ga18      in                       xlk61g04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAANCTGCGTAAAANNNCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGNNNNAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGNCCTTTTNNNNNACAANNC
  5   1   2       bld Ga18      in                       xlk61g04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAATATAAATTTCCCGAGGAGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGNNTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGNCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaatgaaaaaaaaaa
  5   1   2       bld Tbd5                            IMAGE:3579796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTGACACAAACCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCCCCGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaatgaaaaaCATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTGGTGCTTACGATTTATACAAGCAAATGTG
  3   1   2       bld Sp1       in                    IMAGE:4174710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAATTACAGGTATGTTCCAGCGTTTAGATAAACTGCGTAAAACTGCCTTCGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCACAATCTCTGGCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCGTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCTTGGTCGCCGAAAAATACGCGAGTCTGGTTTCCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACAGAAAATAAAAAAAACTGAAATGAAAAA
  3   1   2       bld Ov1                             IMAGE:5073010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCGTGTGGGTGTTCCGGGGCCATGCCATTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAACCATTGTGTCGGCATCAAGGTTTTTTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGCAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Ga15                               XL423p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGTGTGGGTGTTCCGGGGCCATGACCTTGCATTTACACTCTCTGAAGACTGGCAGATTGACTACGAGTCCTACACCTGGAGAAAGCTGGAGAGTGACGGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCaaacggaaaaataaaaaaaactgaaatgaaaaaaaaaa
  5   1   2       bld Ov1                             IMAGE:6317050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAGTGAGGAGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaatgaaaaaCATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGCAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2       bld Ga15      in                       XL421g10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGaaaaataaaaaaaactgaaatgaaaaaCATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATGTGTGTAAGTGATTTATAAAGCTAAATGCATCCGCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL421g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGCAGAACGATGGTCAAGGAATACTTTGCCTGGGAGGGAGAATTCAAGCACGTGGGCAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGAGACGATCTCGTGGTCCCCGTAAGATACGCGAGTCTGGTTTTCACATCTGCTCCAACATCCAGAGCCTTTTAATTTAACAAGACTGCAAACGGAAAAATAAAAAAAACTGAAATGAAAAACATTGTGTCGGCATCAAGGTTTTCTAAATGACGCGTCGTTATGTATTTGGTGCTTACGATTTATACAAGAAAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)