Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012767676 Xl3.1-IMAGE:6958010.5 - 186 ESTs
                                                                       ...-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6958010.5                                                                                                                  CTGCGGAAAGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAATAATAAACAGT
                                                  Xl3.1-CHK-1012685209                                                                                                                        AAAGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAAxAAxAAACAGTGTAGAA
                                                      consensus depths                                                                                                                       4     9     7    12    11    17    13    21    24    32    32    40    42    55    27    59    51    59    51    60    53    61    53    61    53    61    54    61    53    61    54    61    56    61    58    61    61    62    61    62    61    62    61    63    63    63    63    63    64    64    62    64    64    64    64    65    65    65    65    65    64    64    64    65    64    65    65    66    65    67    67    68    67    69    65    69    66    69    66    70    66    70    66    69    66    71    66    69    61    67    51    67    52    67    50    66    50    66    50    66    50    66    48    66    47    65    45    62    46    61    44    59    45    61    42    60    42    59    40    58    39    57    35    56    28    52    28    50    28    49    26    46    26    47    23    44    22    41    24    37    26    37    24    35    23    34    22    34    23    31    23    31    22    31    23    30    23    31    22    30    23    29    25    29    24    29    25    29    24    29    23    27    20    27    23    28    22    28    22    27    22    27    21    27    21    26    21    26    21    26    20    24    19    22    19    21    18    21    18    22    19    23    18    22    19    22    18    21    17    21    18    21    17    20    18    21    17    21    16    21    14    19    14    19    13    22    13    24    13    22    14    22    13    22    13    22    14    24    14    25     9    25    14    26    11    30    13    30    13    31    14    31    11    33    13    34    14    36    13    38    12    39    16    41    12    41    15    45    19    47    21    50    21    50    21    51    21    51    23    52    25    53    28    56    29    57    30    59    31    59    32    58    34    61    37    63    37    64    37    63    42    66    42    68    42    68    43    68    48    73    48    73    52    76    49    76    49    75    49    75    50    76    50    76    51    77    51    78    52    79    50    79    51    79    51    80    52    81    53    82    53    82    54    82    55    83    55    84    55    84    53    84    55    84    55    84    54    84    53    84    53    84    53    84    52    84    52    83    52    83    49    82    48    82    39    77    31    66    24    64    23    54    20    43     9    35     5    21
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAAGTATCGTCGAAATGAATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAATAAGAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAAGGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGGCTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTAATTACATATTGTGCACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGCAGTGTGACTTCCCCTCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTGTGCTCCTTGTGTTGTGATT
                                                                   SNP                                                                                                                                                      ------C-----
                                                                   SNP                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                  ------G-----
                                                                   SNP                                                                                                                                                                                                                              ------G----T
                                                                   SNP                                                                                                                                                                                                                                                                                          ------C----A
                                                                   SNP                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                          --C-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                      --C-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                              -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --AT--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C--G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T--T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T---T------
                                               BLH ATG     123    2991                                                                                                                  
                                               BLH MIN     123     372                                                                                                                  
                                               BLH MPR     123     372                                                                                                                  
                                               BLH OVR     123      63                                                                                                                  
                                               CDS MIN     123      30                                                                                                                  
                                               EST CLI      56      30                                                                                                                  
                                               ORF LNG     123       6                                                                                                                  
  5   1   2       chi Emb4                            IMAGE:5542078.5p TCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGGATTGTACAACCTGATGTCCTCAATTTGATGCCGGACTGCAGATCTCAGAATCTCTTGGGTCGGTGCTTGTAGCCTTCCTGAATTGGCCTTTCGTCTATAACAGTGCCCCTGACTTCTGCACCAGCTTCATCATGGCCTTTCTAATAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACCAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGCCTCAGATTACCAGCCCAGGTGACCTGGTCAGATCCGGGTGGGAGACCTCGAAGGAATTAAGTATCCGTCGAAAATGACCCTGCTCCTTAAATGGTGTCAAGACCAGTGGCCATCCTCGCCTAATGTCCCCCTCCACGGGCCAGGGTACCCTACCCGCTTATTGTGCTCTCGGGCCGCCGCCGGTTTATCAAACGAACTTACCCCTTAGGGCGGAATGGCTCGAGAACGGCGAATGTCCTTGGCCACATGCCGCCCGCGCTCCCAAGTCCCCTCGATTTTTGCCGCCCCACACC
  5   1   2       chi Ga12      in                         XL189o09.5p      GAGGCTGTTCTGAGGCGCTGGGAGAGAGTGAAGGATTGTACAACCTGATGTCCTCAATTTGATGCCGGACTGCAGATCTCAGAATCTCTTGGGTCGGTGCTTGTAGCCTTCCTGAATTGGCCTTTCGTCTATAACAGTGCCCCTGACTTCTGCACCAGCTTCATCATGGCCTTTCTAATAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049450.5p                                            GACCCACGCGTCCGATAGCTTCCTGCAAGCCGCCGTAATCTTCCCGAATGGCTGCGCGTTGACGTAAGCTCTGCGGAAAGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATC
  5   1   2       bld Ga15 5g3  in                       XL504n18ex.5p                                                     GCGCCATAGCTTCCTGCAAGCCGCCGTAATCTTCCCGAATGGCTGCGCGTTGACGTAAGCTCTGCGGAAAGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTANATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTA
  5   1   2       bld Int2 5g                         IMAGE:8526907.5p                                                                                   CCCTATACTGCGNNGGGNTGCATCGATATGAGTTCGTCCCGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAAAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049082.5p                                                                                            ACCCACGCGTCCGCGTATAGCTCTGCGGAAAGGAGAGGGTGTGAGAACTAGTTCGCCATCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202119.5p                                                                                              GCTGCGCGGTGACGTAAGCACTGCGGAAAGGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATATACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGGATGCCAGAGTGCAAGTTTGGAAATGATGACAAAATCGTGATTGAGAAANCAAGCAAA
  5   1   2       bld Int2      in                    IMAGE:8822325.5p                                                                                                            TTATTTAATTCTAGAAACAAAAATTTTTAAAAAATTCGTCCCCTTGTGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAAAAACAAGGCAAATGAACTGCTGATGAAACCTGGCAAACGGGAAAACAATCAATGCCATTGATGACTGTACATTCCACCATGTGGTTCGCTAGCAAATTTGAACTCGAGGCAGCATCAGCTTACTCGAATGAGAATTGAGCTATGAAATATCGACGAACAAGGAATATACATCCTTAC
  5   1   2       bld Int2 5g3  in                    IMAGE:8822301.5p                                                                                                               TGATTATTTTAAAGTATTAttttttttATATATTCGTCCCCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATCGTGATTGAAAAAACAAGGCAAAGAACTGCTGATGAAACTGGCAAACGGGAAAACAATCAATGCCATGATGACTGTACATTCCACAGTGTGTTTCCGGCTTAGCAAATTGACCTCGGAGGCAGCATCAGCTTTAACTCGATTGAAGAAATTGAGCTTAATGAAATATTCGACGCACAAAGGATATACATTC
  5   1   2       bld Sp1  5g                         IMAGE:5512659.5p                                                                                                                           CGGACGCGTGGGCGGACTCTTGGGCGGACACGTGGGCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTACCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAAAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCACAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAACGAATAAAGTATCGTCGAAATGAATTGTTCATAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACATAGCGCTCATGTGTCTGGGCGTGTAGTGATCGAGAGTTACCTGAGCGCAATGCAGACTGCGATTCTGGATGAATGCAAAATCG
  5   1   2       chi FaB       in                    IMAGE:8069426.5p                                                                                                                           GGAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTATCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAACACTATAGACTTTCTTCACCCAACAAGGGATCTAAAGTCTCCTTCAGACCAAGGAGGAGCATTCCCATATTACCAGCCAGGTGACTTGGTCTGATCGTGTGGAGACGTTACAGAATAATATACCCTCTAAATTAAATTGTCTTAAATTTGTTACAAAGTGTCAATTTGCTAATGTCTCTTAAGAGACGAGAACTTACCTCTCCTTGCTCGGGCTTGGGTTTAGAAAAATTCCTTACCGAAC
  5   1   2       bld DMZ  5g3  in                         xl256c23.5p                                                                                                                            GAGAGGGTGGGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCG
  5   1   2       bld Sp1  5g                         IMAGE:5511659.5p                                                                                                                               AGGGTGGGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCCTCAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCCTGAGCGAATGCCCAGAGTGCAGTTTGGAAATGATGACNNAATCGTGATTGAGAAACANGGCAANGACTGCTGATGAA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202913.5p                                                                                                                                  cacgcgtccgcccacgcgtccgcggacgcgtgggCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGG
  5   1   2       bld Emb1 5g                         IMAGE:6635838.5p                                                                                                                                  GTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTANAGACTTTCATCACCCAACAAGGGATTANAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCNAGTGACTGGTCAGATCGGGTGGAGACGTGAAGGGAATAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTACCGCTCATGTGTCTTGGGCGTGGGGNTGATGAAAAAACTACCTCAGTGGAAATGCCAAAGTGGCAAGTTTGGGAATGGATGGAAAAAAATAAGGAATTGGAGAAAACAAGGGCAAAC
  5   1   2       bld Te2  5g                         IMAGE:7210976.5p                                                                                                                                     GGAGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCCTGAGCGAATGCCAGAA
  5   1   2       bld Te2  5g3  in                    IMAGE:7207235.5p                                                                                                                                       AGAAGTAGTTCGCCATCTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGATTGTTCTTAGATGTGTTAGAGAGTGTAATCTGCTAATGTCCCTCAAGGGCAGTACTACGCTCTGTGTCGGCGTGTGTGATGAGAGTACCTGACGATGCAGATGCAGTTTGATGATGAAATCTGATGAAACAGCAAGACTGTATAATGCAACGGACACATGCTGAGAGCATCACAGGTCGTACATGACGACCTCTACTCGG
  5   1   2       bld Neu7 5g3  in                         XL014f01.5p                                                                                                                                            TGCAGGNAATTCGGCACGAGGGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAA
  5   1   2       bld Tbd5      in                    IMAGE:3580652.5p                                                                                                                                                  CTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCCGAGATGACANNTTGGGCTGAATGCTTGTGGATAGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTC
  5   1   2       bld Tbd7 5g3  in                         XL096g13.5p                                                                                                                                                  GGCCTCTTGGGCTCTGTTCTGAGGCGCTGGTAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAG
  5   1   2       bld Brn1 5g                         IMAGE:6954443.5p                                                                                                                                                      TCTTGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAATAAGTAATGAAAAACCAGGCAAAGGAACCGCCCAAGAAACTGGCAAACCGGGAAAACCAATCATTTGCCATTTAACGACTGGTACATTCCCACCCATGTTGTCCCGGGCTTTAACAAATTTTGGACTTTGAAGCGCCAGCATTTAAGCTTTTATAACCCTCCCTTGATGGGAGAAAAACCGAACCTCTTTGGAAGAATTCTCGAAACCCCCCTAGAGGGGAAATTCTTTTTCCCCATCCCATTTTTCG
  5   1   2       bld Neu7 5g3  in                         XL024p24.5p                                                                                                                                                       CGAGGNCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTAC
  5   1   2       bld Sp1  5g                         IMAGE:5513048.5p                                                                                                                                                       CTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCNTATGTCTCCTNCAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGNCGAATGCCCAGAGTGCAGTTTGGAAATGATGACAAATCGTGATTGAGAACAGGCAAGGACTGCTGAGAACTGCAN
  5   1   2       bld Ov1  5g                         IMAGE:8330770.5p                                                                                                                                                       CTTGGCCTCTGTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATATACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAAAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATTCGTCGAAATGAATTGTTCTTAGATGTGTTTGAGAGTGTCCATCTGCTAATGTCTCCTCGAGGGCAGGGACTTAGCGCTCATGTGTCTGGGCGTGTGGGAAGAAGAG
  5   1   2       bld Brn1      in                    IMAGE:4739977.5p                                                                                                                                                        TCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGCAATAGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGACCAGTCTCAGATTTCCAGCCAG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4968764.5p                                                                                                                                                         TATCGTCGACCCACGCGTCCGGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTT
  5   1   2       bld Thy  5g                         IMAGE:8548081.5p                                                                                                                                                         TGGGCTCTGTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATAAAGAACTACCTCAGTGGAATGCCAGAGTGCAATTTTG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175132.5p                                                                                                                                                              CACGCGTCCGGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACA
  5   1   2       bld Tbd1 5g                              AW764460.5p                                                                                                                                                                 GTTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAATATCGTCGAAATGAATTGTTCTTAGATGT
  5   1   2       bld Em10 5g                         IMAGE:8320615.5p                                                                                                                                                                 GTTCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAGAGCTACTCAGTGGATGCAGAGTGCAGTTTGGATGATGNATAATAGTATGAGAACAGGGCAAGACCGCGATGAACTGCAAACGGAACATCATGCATGACACGTCTCACATGGTCGCTACAATGATTACGCCTACTATCTCGAGAATCACTTAATCACCAGATCCTCT
  5   1   2       bld Eye1 5g                         IMAGE:6958010.5p                                                                                                                                                                  TTCTGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGGATGAATGACAAAATCGTGATTGAGAAAACAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGGAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTTGTGTTCGGGNCTTAACAAATTTGACTCGGA
  5   1   2       bld Brn1      in                    IMAGE:6956595.5p                                                                                                                                                                  TCTGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGGACCGCCCGATGAGACTGGCCAAAACGGGGAAAACAATCAATTGCCCATTTGACGACTGTACATTTCCACCAAATGTGGTCCGGGCTTTA
  5   1   2       bld Li1  5g3  in                    IMAGE:5129924.5p                                                                                                                                                                   TGTAATAGCCTGGAATAAAGTGAGTATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTG
  5   1   2       bld Eye1 5g                         IMAGE:6958327.5p                                                                                                                                                                    TGAGGCGCTGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCCGATGAGACTGGCAAAACGGGGAAAACAATCAATTTTGCCATTGACGACTGGTACATTTCCACCCAATGGTGTCC
  5   1   2       bld Te2  5g                         IMAGE:7209891.5p                                                                                                                                                                     TGAGGTGCTGGGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGATGCCAGAGTGCAGTTTGGAATGATGACAAATCGTGATGAGAACAGGGCAAGACTGCTATGAACTGCAANCGGAAAACATCATGCATGATACGTCTTCACATGTGCCGCTACAATGATCGACCACTCCTT
  5   1   2       bld Sp1  5g                         IMAGE:4964125.5p                                                                                                                                                                          CGCTGGGAGAGAGTGCAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGATTA
  5   1   2       bld Ga12 5g3  in                         XL142h21.5p                                                                                                                                                                           GCTGGTAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGGCTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTC
  5   1   2       bld DMZ  5g3  in                         xl336b20.5p                                                                                                                                                                            CTGGGAGAGAGTGAAGATCTAGTTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCA
  5   1   2       bld DMZ  5g3  in                         xl228f11.5p                                                                                                                                                                            CTGGGAGAGAGTGAAGATCTAGTTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAATAGTAATTGAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7765848.5p                                                                                                                                                                             TGGGAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTNCAGGGCAGG
  5   1   2       bld Neu4 5g                         IMAGE:4085358.5p                                                                                                                                                                               GGAGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGT
  5   1   2       bld Neu4 5g                         IMAGE:4085387.5p                                                                                                                                                                                GAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328813.5p                                                                                                                                                                                GAGAGAGTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTG
  5   1   2       bld Ov1  5x                         IMAGE:6316551.5p                                                                                                                                                                                 TAGAGTGAAGATCTAGCTTTCTTTTGCTCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGCTGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTGCCAACATCTGGCTAGCTGCAGTCACCAAACAAGATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGAAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCCAAAGTCCGCATCCGAACCAAGGAGGAGCAGTCCCAGATTACCAAGCCCCGGCGACTGGTCCAGATCGGAGGGCAGACGCTGAACGAATTGCAGTATCGTCCCAAATGAATTTGCCCTTAAATGTGCTTAGCAGAAGGTCAATCTGCCTAAATGTCCCCTCCAGGGGCAGGGGAACTTAAGCCCCCCATGGCGGACTGGGTGTTGTGGGGACTGAAAAAGTCACCCTGGAGCGGCAAATGCCCGCACTGGCAAGCCTCTGGGAATGGAATGGACAAAAATCCCCGGAGTTGGAAAAAACAAGCCGCTCCAGGACACTCGCCTGATGGACAACTCGCCCCCCAACCGGGCACAACCAGCCCAACTTGGGCCCCTGGATGGACTGGCCACACTTCCCACCCCGTGCGCCGTCCCAGGCCTTTAGCTACAGTCTTTACCTTCGCCAATCCCCCACCGCTACCAGCCTATACTTACCGCCCCCG
  5   1   2       bld FaB  5g                         IMAGE:8072338.5p                                                                                                                                                                                  GAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATATACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAANGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTACCTGAGCGGAATGCAGAGTGCAAGTTTGGATGAATGACAATCGTGATGAGAAACAGGCAAGACTGCTGATGAACTGCAAACGGA
  5   1   2       bld Ga18      in                       xlk54b09ex.5p                                                                                                                                                                                  AGAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGNNTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCNNCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTNGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATNNCAGAGTNNAAGTTTGGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAANGAACTGCTGATGAAACTGNNAAAACGGGAAANAATC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202642.5p                                                                                                                                                                                   CACGCGTCCGTCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCC
  5   1   2       bld Sp1  5g                         IMAGE:5511864.5p                                                                                                                                                                                   AGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCCAGAGTGCAGTTTGGAAATGATGACNAAATCGTGATTGAGAAAACAGGCAANGAACTGCTGATGAACTGGCAAACGGGAAACATCAT
  5   1   2       bld Thy  5g                         IMAGE:8548111.5p                                                                                                                                                                                    CCGTGAAGATCTAGCTTTTTAGCATCATGGGAAGGATAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGATGCCAAGTGCAAGTTTGGATGAATGANAAATAGTATTGAGAACAGGCAAGGAACGCGATGAACTGGCAAA
  5   1   2       bld Ga18 5g3  in                      xlk122i19ex.5p                                                                                                                                                                                    GAGAGTGAAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGNNTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCNNTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGNNACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATNNCAGAGTNNAAGTTTNGNAATGAATGANAAAATCGTGATTGAGAAANAANGNAAAGGAACTGCTGATGAAACTNNNAAAACGG
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3549809.5p                                                                                                                                                                                     CGAAGATCTAGCTTTCTTTTCATCATGTTGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATAATGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAAATTGTCTTAGATGTGTTAGAG
  5   1   2       bld Neu7 5g3  in                         XL034c12.5p                                                                                                                                                                                     GTGAAGATCTAGCTTTTTAAGNCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAG
  5   1   2       bld DMZ  5g3  in                         xl297c18.5p                                                                                                                                                                                      GTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAA
  5   1   2       bld DMZ  5g3  in                         xl318c18.5p                                                                                                                                                                                      GTGAAGATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATT
  5   1   2       bld Te2  5g                         IMAGE:7210014.5p                                                                                                                                                                                         AAGATCTAGCTTTCTTTTCATCATGGGAAGGGAAAACTAAGAAGAATTTACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGATTACCTGAGCGGATGCCAGAGTGAAGTTTGGATGAATGACAATCGTGATGAGAACAGGCAAGGACTGCTGAGAACTGGCAACGGGAACATCATTGCATGATACTGTCTCACATGTGCCGCTACAATGATCGACCACTCGCNTACTCGATGAGATTACTTAATCACACAGAT
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3549808.5p                                                                                                                                                                                           AAGACTAGCTTTCTTTTCATTATGGGAAGGGAAAACTAAGAAGAATCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTATATCGAGATGACATTGGGCGGAATGCCGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTA
  5   1   2       bld Kid  5g                         IMAGE:4031293.5p                                                                                                                                                                                           GATCTAGCTTTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCCAAGGGCAAGTTTGGGATTAAATGATAAAAATAGTAATTTGAAGAAACAAGGGAAAAGGAAACCGCCCATTGAAACTTGGCAAAACGGGAAAAACAATCCATTTGGCCATGGACGACTGGTACATTCCCCCAATGTGGTTCCGGGTTTAATAAATTTGGGATCCTGAAGCGCAGACATTAACTTTTATACCCCCCCTGGGTGGGGGAAAATCCCGAGGTTTTTTGGAAATATCCGAAACCCCCCAAGGGGAAATTCATTCTCTTAACCATTTCCGGGGTAATTACCCCCCTT
  5   1   2       bld Tbd7 5g3  in                         XL082g04.5p                                                                                                                                                                                             GCTTTTTAGNCATCATGGGNAAGGAAAAACTAAGNAATAATTCACCATGNATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGNATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTA
  5   1   2       bld Tbd7 5g                              XL078c17.5p                                                                                                                                                                                                    TTTTAAGCATCATGGGAAGGAAAAACTAAGAATAATTCACCATGATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGC
  5   1   2       bld Neu7 5g3  in                         XL023o05.5p                                                                                                                                                                                                                       AAACTAAGNAATAATTCACCATGNATTGGAGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCAGGGTGTACCGAGNATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCT
  5   1   2       bld Tail                            IMAGE:8545440.5p                                                                                                                                                                                                                                       AAAACCCCATAGAGTTNGNNAAGAGTACTACATAAATTCGNCCCGGTCCTTGTCTCCAGGGTGTACCGAGATGACATTGGGCGGAATGCTGTGGATGCCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACT
  5   1   2       bld Neu7      in                         XL044g14.5p                                                                                                                                                                                                                                                                                                                                        CCTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCTGTCACCAACATTGCCCGCACAAGCTTCTTTCACGTGAAACGTTCCAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGA
  5   1   2       bld Neu7                                 XL037d13.5p                                                                                                                                                                                                                                                                                                                                                                            TGCGCTCGCCTGTCACTAACATCGCCCGTACAAGTTTCTTTCACGTTAAACGTTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCCAGGTGACTGGTC
  5   1   2       bld Te2N                            IMAGE:7768461.5p                                                                                                                                                                                                                                                                                                                                                                                                             GCTTCTTTCACGTGAAACGTTCCAACCTCTGGCTAGCTGCAGTCACCAAACAAAATGTCAACGCTGCCTTGGTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATATACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAGCTTG
  5   1   2       bld Kid                             IMAGE:7011260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCACGCGTCCGAAAATGTCAACGCTGCCATGGTCTTTGAGTTCCTTTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGGAGGTCAAGTGGTCATCANATCTAACTTTAACCNTTCACTTCTGGCTCAGAAGATT
  5   1   2       bld Ga15                               XL439a14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTTTGAGTTCCTCTACAAAATGTGTGATGTCATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACT
  5   1   2       bld Ga12      in                         XL165a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAAAATGTGTGATGTNTGACTGCATACTTTGGAAAGATAAGCGAGGAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATA
  5   1   2      shim Ga15      in                       XL418f16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTA
  5   1   2       bld Ov1       in                    IMAGE:8328443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGGTCAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAG
  5   1   2       bld Te2       in                    IMAGE:7391747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACTTTCACTTCTGGCTCAGAAGATTGAGGTGAGATTCCAACTCCACTCACACCAGCGGAGTACAGGTCATCTGTATGAAGGG
  5   1   2       bld Emb1      in                    IMAGE:3401557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGCGTCCGCAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTAGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAG
  5   1   2       bld Egg1                               PBX0153B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGAGGCGAGCTGCTAGATGAAATTCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCATAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAAGAACTGCTGATGAAACTGTCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTTCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGA
  5   1   2       bld Brn2                             Brn2-za45f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTGTGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAAC
  3   1   2       bld Ga18      in                       xlk54b09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAANNAGNNNNNCTAAANNCTTTCNTNNCCCANNAAGGGATCAAAAGTCAGCATCAGNNCANGGAGGAGCAGTCCCAGNTTNCCAGCCAGNNGNCTGGTCAGATCGGGTGGAGNCGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTNAGATGTGTTAGAGAGTGTCAATCTGCTANTGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGANNGCAGCATCAGCTTTATNCCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGTNTTCCTTTCTAAGTGTAACAATATAGAATGNC
  5   1   2       bld Te2       in                    IMAGE:7206875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAACAGGAGCACTAAAGACTTTCATCACCCAACAAGGGATCAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCCCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGANCAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTTGTCGTGAGGTGGGACGCACAAGCTTGAGGTCANGGTGGTCATCAATCTAACTTTAACCTTCACTTCTGCTCAAAAGATTGAGTGAGGATTCNACTCACTCACACTANCGAGTACAGTTATTTGATGAAGGGAAGCCAGTTTAGGCCNTGAAATGCATTGTCTGAAATAA
  5   1   2       bld Thy                             IMAGE:8550147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCACTNNCACTCACACCAGCGGAGTACGGTCATCTGTATGAAAGGAAAAGCAATANANNGCAGTGAGACGCCATTGCTGGAAATAANCGCATGTGGTATGAAGATCTCAATCATGCAAGTTGACTGCTTCTACATGATAGAGAATGGCTCGCTCNATTCATGACTTGAGTCCATTCTCTCNGCTCAATGCTACTGAAGGTGACAACTACTCACACTGAGTATCATGTCATCTGCCATGTCTGAACNGGTACGTCACTAACANGCAGTAATATCTCTCAAGATACCAC
  5   1   2       bld Gas5                            IMAGE:3749209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACCAGCCAGGTGACTGGTCAGATCGGGTGGAGACGTGAAGGAATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAGAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTCTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACANAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGATGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGAACAGCCAAGG
  5   1   2      shim Brn3                            IMAGE:8538310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATNNNCCCTCTCGCTCNNNGAGATCCATCAATTCAATTCGTCCATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAGATTAGTGCAGAGATTGAGCTGCTTCCTACCAACGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCTCCATCTGGCCTCAAAG
  5   1   2       bld Kid                             IMAGE:7012361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTGAAGGAATAAAGTATCGTCGAAATGAATTGTTCTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGTTACCTGAGCGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAGATTAGTGCAGAGATTGAGCTGCTTCCTACCAACGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCTCATCTGGACTCAAGTGCGTACCCTGAAGTGTTGAGCCAAACTAATTACGTGACATGATGTGATCAATGGG
  5   1   2       chi DMZ       in                         xl222e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGATTCTTGCAGCAGGCGCACGTGTGACATGCTGCTGTGACGTTTGGCTCCTCTTCCGGCTCCCTCTCTGGCTCTGCAGCAGACTTCCTTTTCACCGCTGGCCACTTCCACTGCACCGGCTGCAGAGGGGGGTGGTTCGAAAATGTATTGCGGGCCGCAGTTTGGACTCCCCTAGGCTAATGCCACATGAAGATATTTACTTTTCTTTGAAATGTAGTGGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAGATTAGTGCAGAGATTGAGCTGCTTCCTACCAACGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTGAGCAAACTAAGCTTTTGGCATGTGAGCT
  5   1   2       bld Tbd5                            IMAGE:3580232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTTAGATGTGTTAGAGAGTGTCAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTNTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTAT
  5   1   2       bld Oo1                    IMAGE:6640389-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGT
  5   1   2       bld Neu7                                 XL039a13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGAGGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGC
  5   1   2       bld Int2                            IMAGE:8530998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCTGCTAATGTCTCCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATATAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGGAAGTGTTTGAACCAAACTAAACTACAGCGACCATGAG
  5   1   2       bld Ga12      in                         XL177e04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTCAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGATAAAATAGTAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGC
  5   1   2       bld Tail      in                    IMAGE:8541489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAATTNNNNNGCNGGCCATCGAATCTATTCGTCCCTTTGGATGAATGACAAAATCGTGATTGAGAAACAAGGCAAAGGAACTGCTGATGAAACTGGCAAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGAGATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAGATTAGTGCAGAGATTGAGCTGCTTCCTACCAACGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCTCCATCTGGCCTNCAAGTGCGTTACCTGAAGGTGTTTGAGCCAAAACTAAATTACAGTGACCATGATGTGATCAAATGGGTGCGATACATTGGTCGCAGTGGGATCTATGAGACACGGTGTTAATGCATCACATTAATAAGAAAACAGTGGCCCCAGCTCTAAAGCT
  5   1   2       bld Tad1      in                    IMAGE:6877119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATTGAGAAACAAGGCAAAGGAACCGCCGATGAGACTGGCAAAACGGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCTTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGAAGTGGCCCCAGCTCTAAACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTCTTTAGCATGGGAAGGCATCATCATTTTATAAAGGGGGCTCCCTTTTGAATGGAATATC
  5   1   2       bld Ga15                               XL419f16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACAAGGCAAAGGAACTGCTGATGAAACTGGCNAAACGGGAAAACAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCGGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATATGAGCTTATGANATATCGAACGACAAAGGATATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAGGTGGGACGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGGATTCCCAACTCCACTCAACAC
  5   1   2       bld Tbd7      in                         XL081a23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAAACAATCAATTGCCATTGACGACTGTACATTCCACCAATGTGTCCGGCTTANCAAATTTGACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAG
  5   1   2       chi DMZ       in                         xl324k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAGAACTAGTCTCGAGtttttttttttATGGTTTTAATATGAATGCTTTATAAATATGTTTTANATATCGAACGACAAAGGATATCATCCTACCATTCCGNGTCATTCCTCTTGTTCGTGAGGNGGGACGCACAAAGCTTGAGGTCAAGGNGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAAAANATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAAATTAGTGCANAGATTGAGCTGCTTCCTACCAACGATAANAANAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAGCCAAAACTAAATTACAGTGACCATGATGTGATCAAATGGGTGCGATACATTGGTCGCAGTGGGATCTATGAGACACGGTGTTAATGCATCACATTAATAAGAAAACAGTGGCCCCAGCTCTAAAGTTGAAGTCCTTTCATTCAGAAAAGCAAGTCAACACTCTTAACAAAGGGGTCAGA
  5   1   2       bld Emb4                            IMAGE:5572709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTCTGAGCGCAGCATTAGCTTTATACCTCCTGATGGAGAATACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGNGTCTGAATGGGCAGAGATTTGAAAGGTGTCAGATAGCCCCTTCCTTTATTCCCACNCTGAACATAATAACAACNCTTTGCTCCATTATACTTTTTACTTTTGTTCCATTGGTTTAAACATTTGGAAGGGCATCATCAATTTTTATAAAGGTGTTGCTCCCCTTTTGAATATGGGAATATCCCTCTGGGGGCCCATAGTTTCCCAGCCCTGGGTTGGTGGTCAATTAAACCAACCTTGAACATGGCCTGGGCCCA
  5   1   2       bld Brn3                            IMAGE:8541172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGAAACGAGCTTATGAGATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATCCCACCTGAACATAATAACACCTTTGCTCCATATACTTTTACTTTGTCCCATGTTNNAGCATGAGGCATCTCATTATAAGTGTGCTCCTTGATATGATATCTCTGGCATAGTCAGCTGTGTGCATACACTGACTGCGCAGTCGTACTCTCATGCATCGGAATGAACGAGATCTGTATCAGCTCC
  5   1   2       bld Tad2      in                    IMAGE:6872062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATCGAACCACAAAGGACATCATCCTACCATTCCGTGTCATCCCTCTTGTTCGTGAGGTGGGACGTACAAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGGCTCCATTAATACTTTTACTTTGTTCCATTGGTTTAGCATTTGGAGGGGCAT
  5   1   2       bld Brn1      in                    IMAGE:6950627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGAATTCTCGGGATTACAAGCTTGAGGTCAAAGTGGTCATCAAATCTAACTTTAAACCTTCACTTCTGGCTCAGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCCTGTTTAGTCTAGTGCTTTCCACTACCATCCCCAACCCTACTCATCATGGAAACTGGCAACC
  3   1   2       chi Tad2      in                    IMAGE:6872062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCGGGTAGTATACAAGGTTCCACTACTGGTAACGGAAGGGGGGAAAAAACGCCAAAAGGTATTAAAGGGGCCCAGGGTAGGAAAACGCCCCTTTGTTTTTGGGACAAAATAAAAAGGCGCCATGGGCCTTGTTAGAAAGGGAAATTTTCAGGATTCAAGGGCAAGGGGAATTGAGGGCTGCTTTCCTACCAAATGATAAAGAAAGAAATTGGGGGTTCGGCCTTTCCGAATATCCCTGGAAATTTTGAGGGTCCCATTTTGGTTCCATCTGGGCCCTCAAAGGTGGCGTTACCTAACGAGTGTTTGAACCCAAAACTAAATAACAGGGAACCATGATGTGATCAAAGGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGGTGTTAATGCTTCACAAAGCTGACAACGGGAGTGGCCCCAGCTCTAAATTCTGAATTCGTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCAGGAAGTTTCGCAGGTTATAAAAAACCCACGCGTAGAAGNGCTTCTCAATTTTGNCGGCGAGGGGGGGG
  5   1   2       bld Tail                            IMAGE:8543851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAANGNNTCCTGATGCNNNNNGNAGTACCTAATAAATTCGTCCCATTGAGGTGAGGATTCCAACTCCACTCAACACTAGCGGAGTACAGGTCATCTGTATGAAGGGGAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAGTCTCAGATTAGTGCAGAGATTGAGCTGCTTCCTACCAACGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAGCCAAAACTAAATTACAGTGACCATGATGTGATCAAATGGGTGCGATACATTGGTCGCAGTGGGATCTATGAGACACGGTGTTAATGCATCACATTAATAAGAAAACAGTGGCCCCAGCTCTAAAGTTGAAGTCCTTTCATTCAGAAAAGCAAGTCAACACTCTTAACAAAGGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAAATACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTATGCCCATCTGTGAATATAAATACTGATCGTATTCTGTGTAGTGTTCCCACAACATCCCACCTTACTCATCATGGACTGCACCTTTCTAGTGACTGTCCTATATTCTGCTATTACAATTATACCTGCAAGGCACAATCTTCAGACGTACACG
  5   1   2       bld Lmb1      in                    IMAGE:8532764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTAAACTTTTGCAGAGCACATCGATTCGTATTCGTCCCGAAGATTGAGGTGAGAATTCCAACTCCACTCAACACCAGCGGAGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGT
  5   1   2       bld Neu7      in                         XL043p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGNCTGCAGGNAATTCGGCACGAGGTCCAACTCCACTCAACACCAGCGGNGTACAGGTCATCTGTATGAAGGGAAAAGCAAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAC
  5   1   2       bld Gas5      in                    IMAGE:3749135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGTATAAGGCCAGTGAGAACGCCATTGTCTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCT
  3   1   2       chi Tad2      in                    IMAGE:6872931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGAGACAGGTTGTGAACGATGACGTTGATTGGTGATTGCGTTGAGTACACGTACTATATGCTCATATGGAACTATCGGTGGGGTGTATGTATAGTCTATTTAATTTCGGTAATATGATGGTTTGTGAGTTAGGGAAGAGTCCGCGTAAAATTACCATTCTACGAAAGAGAACGTGAGTCTTGAGTTGACATCTTTAATACTGGCCGTGTGTCATTATGCGTGCTGGGGACATGTCCTAATGCATGTTGGGGATTGGCGGTTATTGCAGCGGTCCGGTCGATGCATGAGGATTTCCTTTAACGCACAAAGCAATGATNCAATGTGTAATAGGGTCAAACTATAGTAATACAGCATAAAATAAATTGAATGGAGACATGTGGAGTGTGTATGGAAGAACTCGAATCGCTGCATGAGTGATAATCATTAGCCGCGGTCAACGTGCGTCGTGGTTTGTTGTTTTAGTAGTCAATTGTTTGTCATCCATCTGCTTGTATGAGAAGCCTTTTGTTATAACGGTAATTTATTCAGTGGTGGGGGTACTAGAAAATTTGTGCTCGGGAATTCAGTTCAATTGCGGCCGGTTATGGACCGGAGAGTGTTAATGGTGGGTGTAATACTTTCCAATACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCAC
  5   1   2       bld Neu7      in                         XL016i07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGCATGGCTGGTATGAAGGAATCTCAGATCAGTGCAGAGATTGAGCTGCTTCCTACCAATGATAAGAAGAAATGGGCTCGGCCTCCGATATCCATGAACTTTGAGGTCCCATTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCT
  5   1   2       bld Emb4      in                    IMAGE:4958904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCCATATCCATGAACTTTGAGGTCCCGTTTGCTCCATCTGGCCTCAAAGTGCGTTACCTGAAGGTGTTTGAGCCAAAACTAAATTACAGTGACCATGATGTGATCAAATGGGTGCGATACATTGGTCGCAGTGGGATCTATGAGACACGGTGTTAATGCATCACATTAATAAGAAAACAGTGGCCCCAGCTCTAAAGCTGAAGTCCTTTCATTCAGAAAAGCAAGTCAACACTCTTAACAAAGGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAAC
  3   1   2       chi Tad1                            IMAGE:6880135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAGTGAAACCACACGCGGGATGTGTTTTAAAAATGGGTTTTTTCCAACACANAAGAGGGTTTGGAACTAAAAACGGGGAAAGTTAGGGCCCCCCCCAGGCTTTCTAAAAAATTTTGGGAAATTGCCCTTTTTCAATTTACAATTAAAAGGGGAAGTTCCAACCACGCTTAAACCCCAAGGGGGTTATTGAAATGGCCCAGGGATTTGGAAAGGTGTCAAGATAGGCCCTTTTCCTTTAATTCCCACCTTGAACATTAATAACAACCCTTTGCTCCCATTATACTTTTACTTTGTTCCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACTTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCCGTTCCTCCCTTTTTGGAAAAACCTTCCANNTGAACACAACTCGACTTTAATATAGAANGTGAGGTGANNNGGGGGGAAANNTTTT
  5   1   2       bld Tbd7      in                         XL057e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCAGGCAATTCGGCACGAGGATTACAGTGACCATGATGTGATNAATGGGTGCGATACATTGGTCGCAGTGGGATCTATGAGACACGGTGTTAATGCATCACATTAATAAGAAAACAGTGGCCCCAGCTCTAAAGCTGAAGTCCTTTCATTCAGAAAAGCAAGTCAACACTCTTAACAAAGGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGNATA
  3   1   2       bld Int2 5g3  in                    IMAGE:8822301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCGAACTCCAAGTGCGTTACTGAGGTTGAGCCACTATTACATGACCATGATGGATCAATGGTGCGATACATGTCGCAGTGGATCTATGAGACACGTGTTATGCATCACATATAAGAAAACAGTGGCCCAGCTCTAAAGCTGAGTCTTTCATCAGAAAAGCAGTCACACTCTACAAAGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCATCCTTTTTCCCACTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCT
  3   1   2       bld Int2      in                    IMAGE:8822325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCATCGGACTCCAATAGCGTAACTGAAGGTTGAGCAACTATACAGTGACATGATGGATCATGGTGCGATCATGTGCAGTGGATCCTTGAGACACCGGTTATGCATCCACATATAAGAAAACAGTGGCCCAGCTCTAAGCTGAGTCTTTCATCAGAAAAGCAGTCACACCTCTAACAAAGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCTCCTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCT
  3   1   2       bld Brn1      in                    IMAGE:6956595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACCAAATGGGGTGGCGATTCCTTTGGCCGCCAGTGGGGATCTATGGAGAACACGGTTTTAATGGTTTCACAAAAGCTGACAAACGGAGTGGGCCCCCAGCTTTAAATTTGGAAATTCCTTTTCATTCAATAAAGGGAAGTCAACACGCTTAACCCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACTTTTGCTTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCNGTTTTTCTTGTGACTCTCAAACCTT
  3   1   2       chi Tad1      in                    IMAGE:6877119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGGGGGGTTTTTTTTTTTGGAGGAAACCCCCCGGGGGGGTTTAAAAAAAGGTGTTTCACCAAAAAAAGGGCGGGGAAAAAAAAGAAAAAATGTGGGGCCCCCCCCAAGTTTTTTATAAAACCCCGGGGACCCTTTTTTTTTCCCCCCCCCTTTTGGGGCTCCCCCAATAAAAACTTTTTTAACCTTTGGTTTCCCCTATTTCTTTTTAGCCCCTTGGGGGGGGGCACTCCCCCATTTTTTTTAAAGGGGGTGGTTCCCCCCTTTGGTTAGGGGGAATTTTTCTTTTGGGGGCCCATATGGTTTTCAGGCCAGGGGGGGGTTCCAAATAACCCCCCCTTGAACATGGGTGCGCCCAGTTCCCATTTTTTTTTTTTTAATGGCCCCATTCTGTGAAATTATTGGTAACCGGATAGGTATTTTTGGTTTAAGTTTAAGGGTTTTTCCAATACCCATCCCCAACCCTTAATTCATCATGGAATTGGAACCTTTTTTGGGTTGACTGTTCCCTATTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTTGCACTGTTTTTAAATGTACCGCACTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGNGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGTATGGATTTAACCATATCATGGCCAGAGTTAATCATTAGTGCTGGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTTTTGTGATTTGCTCTGTTGGACTCTGGACTNCGAAAACCGTGCATGTATAGGCCTTGTGAACGGNNTTTTTTTGGTAATGGGTTAAGGGTNGNAAGGGGGGAAAAG
  3   1   2       bld Tail      in                    IMAGE:8541489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGGATGTGGATCAAATTGGGTGCGAATACATGTTCGCAGTGAATCTATGAGACACGTGTATGCATCACATTATAGAAACAGTGCCCCAGCTCTAAAGCTGAGTCTTTCATCAGAAAAGCAAGTCAACACTCTTAACAAAGGGGTCAGAATGGGCAAGATATGAAGGTGTGAGACAGCCTTCCTTTTTTCCCACTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTTCCTTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTCTTTGGACCCCTCCAACACTGAACCAAATAATAAAAC
  3   1   2       bld Brn1      in                    IMAGE:6950627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTATGAGACACGGGTGTTAATGCTTCACAAAGCTGACAACCGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAAGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACCATTTCTGTGTTCCTTGTGTTGTGATTTCTTGG
  5   1   2       bld Te2N      in                    IMAGE:7202837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACACGGTGTTAATGCTTCACAAAGCTGACAACGGAGTGGCCCCAGCTCTAAATCTGAATTCCTTTCATTCAATAAAGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACATATCATGGGCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTCTGTGCTCCTTGGTGTGTGATTGGCTCTGTTTTTCTTTGTGACTCTTCAACTGATACAGGTAATAAAAATGGTTAAAAT
  3   1   2       bld Te2N      in                    IMAGE:7202837.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTAGCTAGCATAGGCAAGACAGTCTCGATTCGGATAACAGGTATGTCACAGTGCACGATGCCCAGTTAATCGATTCTTCATCATAAGAAGTCACAGCTACAAGGGTCTGATGGCAGATTGAAGTGTCAGAAGCCCTCCTTTATCCCACCGAACATAATAACAACCTTGCTCCATTAACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGACTCTCAACTGACAAGATAACAGACTTT
  3   1   2       bld Spl                             IMAGE:8464710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTATTTTCTTTGTATGGGACAGTGGGATTAGAAGGTAGTCTTATAAACGGGCCATTTAATGATCTTCTCGAAACATTACTTTTACAGGGTCGATGCAAGTTGAGGTGGACAGCCTTCTTTTTCCACTGACAAACAACTTGTTCATATACTTTACTTGTNCCTTCTTTGCATTGAGGATTCATTATTACAAAGGCGCTCTCAATGATTGGAATATCCTCTGGGCCATAGTGNCAGTGCAGCTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCTTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGGGGCAGTGCGCCTTCCCCTCACATTTATGTGCTCCTTGTGTTTTGATTGCTCTGCTAATCAAAACACACGAGCACAGCAGTAGGGGCTACC
  3   1   2       bld Ga15 5g3  in                       XL504n18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCCCAGCTCTAAATCTGAATTTCCTTTCATTCAATAAAGGGAAGTCAACACGCTAACCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTT
  3   1   2       bld Ga18 5g3  in                      xlk122i19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANAAANCANNGNCCNGCNNNAAGTNGANNNCCTTTCATNAGAAAANCAANNNANNCNNNNNAAAGGGGTCAGAATGGNCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATANCCAACTTTGCTCCATTATACTTTTNCTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGNTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGNCTTCCCCTCACATTTCTGTNCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTNNNNNNNTCA
  5  -1   2       bld Sp1                             IMAGE:5506208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGAAACAGTGCCCCGCTTNAAGTGAGTCNTTCATCAGAAAGCAGTCACATCTCACAACGNGTCAGATGGGCAGCATATGAAGTGTGAGACAGCCCTTCNTTTTTCCCACATGAACATACTCACTATGCTCCACTATACTTGTACTTTGTCCGTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTACCTCACATTCAACACGACAAATATAACAGCC
  3   1   2       bld FaB       in                    IMAGE:8069426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCTAAAGGCTGAAGTCCTTTCATCAGAAAAGGCAAGTCAACACTCTACAAAGGGGTCAGATGGGCAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACAGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTATGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGTATTTGTCTCTGTTTTTTCTTTTTGACCCTCAAACTTTATTCTTAGTATAATCTTTAACTTC
  3   1   2       bld Lmb1      in                    IMAGE:8532764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCAGCTCTAAATCTGAATCCTTTCATCAATAAAGGAAGTCAACACGCTAACCAAGGGTCTGAATGGGCAGGATTTGAAGTGTCAGATAGCCTTCCTTTATTCCCACTGAACATAATAACAACATTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCT
  3   1   2       bld DMZ  5g3  in                         xl318c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTCAATAAAAGGAAGTCAACACNNCTAACCAAGGGGTCTGAATGGGNCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTNCNCATTGNACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATNTGCTCTGTTT
  3   1   2       bld Te2       in                    IMAGE:7391747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAAGAAGTCACACGCTACCAGGGTCTGATGGCGGATTGAGTGTCAGATACCCTCCTTATTCCCACCGAACATATAACAACCTTGCTCCATATACTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAGGGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTGCTCTGTTTTCTTGGACTCGCAACTACAAGAAACCGAC
  3   1   2       bld DMZ  5g3  in                         xl336b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGAT
  3   1   2       bld DMZ  5g3  in                         xl297c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCANGGGGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCNTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGT
  3   1   2       bld DMZ  5g3  in                         xl228f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCTGAATGGGCAGGATTTGAAGGTGTCAGATAGCCCTTCCTTTATTCCCACCTGAACATAATAACAACCTTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGT
  3   1   2       bld Te2       in                    IMAGE:7206875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAAGATATGAGGGTGTGAGACAGCCCTTCCTTTTTTTCCCACCTGAACAAAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGTCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGGACCCTCAACACTGTACAAAATAATA
  5   1   2       bld Eye1                            IMAGE:6959024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGATATGAAGGTGTGAGACAGCCCTTCCTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTtatatatatacgatatatTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAACCCNAAN
  3   1   2       bld DMZ       in                         xl324k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAGGTGTGAGACAGCCCTTCCTTTTTTTCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTNTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTNTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCNTGTGTTGTGATNTGCTCTGT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGACAGCCTTCCTTTTTTCCCACNTGAACATAACCAACTTGCTCCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACAATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTATGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTCTTGGACCCCAAACTGACAATGTAGCAGCGAAN
  5  -1   2       bld Emb4                            IMAGE:5536437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAGACAGCCTTTCTTTTTTCCCCACCTGAACATAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTG
  5  -1   2       chi Sp1                             IMAGE:5506488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGAAAGAGAGATCGAACCAGTTGTTGGAAGAAAATTATTTGAAGCAGGATCAAGACAGAGAGGGGTCTTTTTGGTTTCTAAATTGGAGAAATCAAGCAGCGATAATGGGTGGAAGCATAAGAGAGTATTGATTAGCGGACATTTGGTATAGGTAGAATGCCTTTTAAGATGACATGCAGGCATAAGATATTGGTGTAGAGGAGCTAGGGAGACCAGANNNAGNANNGNNGCANGNNNNNANNNNNCCTCAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAATATAAGC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7765848.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGCCTTCTTTATCCCACTGACATAAAACAACTTGCTCCATATATTTTACTTGTTCCATGTTTAGCATGGAGGGCATCATCATTATAAGGTGTGCTNCCTTGATATGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld DMZ       in                         xl222e12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGAACAAAACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGCTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCTTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTTTGATTTGCTCTGTTTTTCTTG
  3   1   2       bld DMZ  5g3  in                         xl256c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAACATAACCAACTTTGCTTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATNTGCTCT
  3   1   2       bld Te2  5g3  in                    IMAGE:7207235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCAACTTTGCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTATGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTCTTCTTTGGACCCTCAAACGTACAAATAATAAACCCG
  3   1   2       bld Neu7      in                         XL016i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGNCGCTGTTTTT
  3   1   2       bld Neu7      in                         XL044g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCCATTATACTTTTACTTTGTTCCCTTCTTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTATATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTATTTGCTCTGTTTTT
  3   1   2       bld Neu7 5g3  in                         XL034c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTCCATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGGACTCTCAAACTGTACAAGTAATAAACAGTG
  3   1   2       bld Neu7      in                         XL043p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAA
  5   1   2       bld Tail      in                    IMAGE:8542317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAATGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTTCTTGTGACTCTCAAACTGTACAAGTATAAACAGTGTAGAACTTCAAANNANNNNNNNNANNNAAANaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAAGCCTGATTTCTAACCCCGCCGACTCTTCCTAAATGAGCAATACTAATCA
  3   1   2       bld Tail      in                    IMAGE:8542317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATACTTTTACTTTGTTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAATGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCATCGT
  3   1   2       bld Neu7 5g3  in                         XL023o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCNCTGTTTTTCTTTGNACTCTCAAACTGTACAAGTAATAAACAGT
  3   1   2      seed Ga12      in                         XL189o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGTTTAGCATTGGAGGGCATCATCATTTATAAGGTGTGCTCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACT
  3   1   2       bld Neu7 5g3  in                         XL014f01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAGCATTGGAGGACTTCATTATTTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTATATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGNCNCTGTTTTTNCNTTGGACCCTCAAACTGTACAAATAATAAACAGT
  3   1   2       bld Ga15      in                       XL418f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATTATTTNGCAAAGNGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGNTGCAGTTTGGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTC
  3   1   2       bld Ov1       in                    IMAGE:8328443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTACAAAGTGCGCTCTCAATGATATGGAATATCCTCTGGGCCATAGTTGCAGTGCAGTTTGCTAATAACTGCCTGACATGTAATTAGCTCTGACCAGGCCGTCTCTTCTCTAATGCCCATCTGTGAATATTAATAACTGATCGTATTCTTGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTGCATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACCAGTGTAGAACACAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328813.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCTTTGATATGGAATATCCTCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACCAGTGTAGAACTCAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7 5g3  in                         XL082g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGGGCCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTNCTGTGCTNCCTTGTGTTGTGATTT
  3   1   2       bld Tbd7 5g3  in                         XL096g13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGNACTCTCAAACTGTACAAGTAATAAACAGT
  3   1   2       bld Tbd7                                 XL086i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGTTTCAGCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGNACTCTCAAACTGTACAAGTAATAAACAGTG
  3   1   2       bld Ga12                                 XL155m12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTCAGCCTGGTGTGTCAATAACCACNTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGNATTTGCTCTGTTTTTTTTGNACTCTCA
  3   1   2       bld Ga12      in                         XL165a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTGGTGTGTCAATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTNTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCTTTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAA
  5   1   2       bld Skin                            IMAGE:8644792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATAACCACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCATCTGTCTGTCTAGTGGTTATTTTGGTAACATTATCATATGATCCTGGCCTATCGTGAGATTAAACATACGTTATGTGTACACGAATAAACATTTTGTATaaaaaaaaaaaaaaaaaaaaaaGGCGGCCGCAGCTGATTCCTAGACGCGCTCAGCTCCGCCTATATGATCTATACTAATCAACTGAAGATCTGTGATTGACACCACTAATGATGAAATC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5049450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCTGACATGCTGCCCAGTCCGTATCTTCTCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12 5g3  in                         XL142h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTAATGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACNTAAAAAAAAAGGCACNAAATAAAA
  3   1   2       bld Tbd7      in                         XL057e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTAATGCCCATCTGTGAATATTAATAACTGATNGTATTCTTGTATAGTGTAGTGTTTCCCACAAACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATATGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGNACCCTCAAACNGTACAAATAATAAACAGT
  5   1   2       bld Emb4                            IMAGE:5541962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCCCATCTGTGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCaaaaaaaaaaaaaaaG
  3   1   2       bld Ga15                               XL430g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCTGTGAATATTGATAACAGATAGTATTNTCGTTTAGTNTAGTGCTTTCCACTACCATCCCAACCCTANTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACNCTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAANCGGGGAGTGAATGGATTTAACCATATACATGGCCAGAGTTGCANCAGGAATGGTTTTGCTATTNGTGGACANGTGTGAACTTACCCCTCACATTTGCTGTGCTGCCCTTGTGTTGTGA
  5   1   2       bld Ga15      in                       XL462c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCCNaaaaaaaaa
  3   1   2       bld Ga15      in                       XL462c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAATATTGATAACAGATAGTATTCTTGTTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTT
  5   1   2       chi Tad2      in                    IMAGE:6872931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGATAACAGATAGTATTCTTGGTTAGTCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGCTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAGACTGTACAAGTAATAAACAGTGTAGAGCCCGCCCACAATGTGCCAATTTATGAAGGATCTTGTCTGCCGCCTGCGGCctcgagaagctttctagaccattcttttggcgcgcgggcccaCTAGGTAATTGAACATGGGAATAGCTGTTTCCTAGGAGAATCTGGTCATGACTAGATGCTGGGAATCCTCACCAATAAAAAACTGCCCGGAGGGCAACCCGAGGCGGTCCTGAAACAAATCCACGAGGGAAGTTCCTGAG
  3   1   2       bld Emb4                            IMAGE:4203262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCA
  3   1   2       bld Ga12      in                         XL177e04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTAGTGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTTTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAANAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTNACTTCCCCTC
  5   1   2       bld Ga15      in                       XL427m23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL427m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTTTCCACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4202913.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTACCATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd3 5g3  in                    IMAGE:3549808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACATCCCAACCCTACTCATCATGGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGCAGCCTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACTTTCTGTGCTCCTTGTGTTTTGATTTGCTNTGTTTTTNCTT
  5   1   2       bld Emb4                            IMAGE:4680374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGCGTCCGAACTGGCAACCTTCTTAGGTTGACTGTTCCCTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAAC
  3   1   2       bld Neu7 5g3  in                         XL024p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGGCAACCTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGNACTCTCAAACTGTACAAGTAATAAACAGTG
  3   1   2       bld Li1  5g3  in                    IMAGE:5129924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCA
  3   1   2       bld Emb4                            IMAGE:4960180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5049082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACAAAGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCGGGAAAAAAAAAAAAA
  3   1   2       bld Tbd1                                 AW764828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCTTAGGTTGACTGTTCCNTAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCACAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTTTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAACACAAA
  3   1   2       bld Gas5      in                    IMAGE:3749135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGGGTTGACTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAACGGATTTAACCATATCATGGCCAGAGTTGCACAAAAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGATA
  3   1   2       bld Tbd7      in                         XL081a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTTCCCTAGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACANCTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGNAAGGTTTCGCACTGTTTTTAAATGNACCGCGCTATTTTATGTGNCCAAATAAGAGGTGAGGGATACTTCNACAGGTGCTTATGTTNCTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGNACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTANCGGGGAGTGAATGGANTTAACCATATCATGGCCAGAGNTGCACAGGAATGGCTTTGCTATTTG
  3   1   2       bld Emb1      in                    IMAGE:3401557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTATTTCTTTCATATATACAATTTTCACACTGTCAAAGGCCAGCAGAATCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAAGTAAAAGAAAGAAGAAAAAAAAAATATCT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4202642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTATTTCTTACATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAACA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4968764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTATTTCTTATATATATACGATATATTAACACTGTCAAAGGCCAGCAGAGTCTTTCCAGAGCAGTAGCAACAGCTGAGCAGAAGTTAGAGCATTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTCTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAACACAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4739977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTTCCAGAGCAGCAGGAACAACTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAAAAAAAAA
  3   1   2       bld Egg1                            IMAGE:3300584.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGCAGAAGTTTTAGAGCATTCGGCTGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAAAAAAAA
  3   1   2       bld Tbd3 5g3  in                    IMAGE:3549809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTAGAGCTTTGGGTTCAGTATGTGGCATGGAAGGTTTCACATTGTTTCTAAATGTAACGACTTTAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGACTGCCCAAGTAATTACATATTGTGCACACATGGCACTTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTGTTATTTGTGGCAGTGTGNCTTCCCCTCCCATTTCTGTGCTNCTTGTGTTTTGATTTGCTCTGTTTTCTTTGT
  3   1   2       bld Tbd5      in                    IMAGE:3580652.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGTATGTGGCATGGAAGGTTTCGCACTGTTTTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAAA
  5   1   2       bld Bla1      out                   IMAGE:3379567.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTAAATGTACCGCGCTATTTTATGTGACCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATT
  3   1   2       bld Emb4      in                    IMAGE:4958904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGCACTCTATTTTGTGTGACCAAATAAGAGATGAGGGATACTTTGGAGTTCTATAGGTGCTCATGTTAATGCTGAAGGCTGCACAAGTAATTACATATTGTGCACACATGGCACTTCTGTGTCCTTTAGCTCCTGCAGTAAAAGGGAGTTTATGGATTTAACCATATCATTGCCAGAGTTAATCATTAGTGCTGGCACAGGATTGATTTTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACCCTCAAACTGTACAAATAATAAACAGTGTAGAACA
  3   1   2       bld Ga18      in                      xlk159o07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAATAAGAGGTGAGGGATACTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTNTNACTCTCAAACTGTACA
  5   1   2       bld Ga18      in                      xlk159o07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATAAGAGGNGAGNNNNNTTCTACAGGTGCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCaaaaaaaaaa
  5   1   2       bld Emb4                            IMAGE:4930379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTATGTTACTGCTGAAGGTTGCATTAGAAAGAATAAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCaaaaaaaaaaaaaaaG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGTTGCATTAGAAAGAATCAATTGTGTACACATTGCACTTCTGTGTCCTTTGGCTCCTGCAGTAACGGGGAGTGAATGGATTTAACCATATCATGGCCAGAGTTGCACAGGAATGGTTTTGCTATTTGTGGCAGTGTGACTTCCCCTCACATTTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACTCTCAAACTGTACAAGTAATAAACAGTGTAGAACTCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)