Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL475c14ex.5.5                       93 PI      87         17     1006                (no blast hit)

 This cluster: approximate FL confidence score = 82%

 1012767830 Xl3.1-IMAGE:7977507.5 - 87 ESTs
                                                                       -70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7977507.5                                                                       CAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTGGCAAAAAAC
                                                  Xl3.1-CHK-1012685755                                                                             CACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTGGCAAAAAACAACGTA
                                                      consensus depths                                                                           11    15    25    31    26    37    25    39    29    41    32    42    33    43    32    43    42    43    42    43    41    43    41    43    41    43    41    43    42    43    41    43    41    43    41    44    41    44    44    46    44    46    45    47    45    47    45    47    45    47    46    49    47    49    47    49    47    49    46    49    45    49    47    50    48    51    48    53    46    54    46    55    45    55    48    55    45    55    40    55    45    55    40    55    43    54    46    54    45    53    44    54    43    54    44    55    41    55    37    56    43    55    42    55    41    53    40    51    35    50    33    47    23    45    28    45    19    44    19    43    22    36    21    34    21    36    20    34    20    32    20    32    22    30    20    29    20    30    19    31    21    31    20    31    20    30    19    30    20    31    20    30    19    30    21    31    21    31    20    31    21    31    22    32    23    33    22    33    19    32    22    31    19    31    19    29    11    29    12    28    14    29    12    29    13    31    14    31    13    31    14    30    14    30    14    30    14    30    14    30    11    27    13    21    12    22    12    20    10    19    15    21    16    22    16    22    15    23    17    23    16    21    17    22    16    22    15    20    16    20    17    20    17    20    17    20    18    20    16    20    16    20    15    20    17    20    14    18    12    18    11    18    12    18    12    18    11    18    11    18    11    18    11    18    11    18     9    16     9    15     9    15     8    15     3    14     2    11
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCTTGTACAA
                                                                   SNP                                                                                                                                                                                                                       --T---------
                                                                   SNP                                                                                                                                                                                                                                   -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------A---
                                               BLH ATG      40      99                                                                       
                                               BLH MIN      40      27                                                                       
                                               BLH MPR      40      27                                                                       
                                               BLH OVR      40      72                                                                       
                                               CDS MIN      40      45                                                                       
                                               EST CLI      -2      45                                                                       
                                               ORF LNG      40       4                                                                       
  5   1   2       bld Ooc1 5x3                          xlnoc003p02.5p CTCTCTCCACTCCTGCTCCCTTTCTATATAAGCTTCCCAAGTCCTTGCCCAGACACATCCACATCGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGGCACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGGCCAGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTNCCTAAAAGAAAANAGATACTGAGTGGCAAGCCTGATGCCACTAAGGGAGNCCACCTACTGTGCCCACTGGAACAGACCCCCCAGAAAAAAGATTCGATGAAACCATGGCACCCATCGAATCTAGAAGAAAATACACTTAAAGaaaaaaaaCACCATCCCTCTCTCC
  5   1   2       bld Em10 5x3                        IMAGE:8318278.5p                                               TATTAGAAAAAAAGTTTTTCGGTCCGGAGTTCCCGGGATTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGTCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCCCTCCTATCACCGATTATTTCCCTaaaagaaaaaaaGATACTGAGTGCCAAGCCTGATGCCACTAAAGGGAGTCTCACCTACTGTGCCCACTGGAACAGACTCCCCAGAAAAGATTCGATGAAACCCTGTCACAATCGAATCTAGAAGAAATCTACACTTAAGGACTAAATAAA
  5   1   2       bld Em10 5g                         IMAGE:8318224.5p                                                     CAGGTTTTTCGGGTCCGGAATTCCCGGGATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCTCAAAGGAGAACGCATAGAAAACCGTCAAGCGGTGCCAGGGATTTAGAGGTCCAGCCCAAGGC
  5   1   2       bld Lmb1 5x3                        IMAGE:8532779.5p                                                      TAGTTCTAGATCGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCTATCGATCACGATGAGATGAGGTCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAgaaaaaattaaacttaaggaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAAGGAGTGAAGGAAGGAGTCAAG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959795.5p                                                         CACGCGTTCGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCTTTTCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAA
  5   1   2       bld Em10 5x3                        IMAGE:7981248.5p                                                                TCGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCCAGAAAAGATTCGATGAAACATGGCACCATCGAATCTAGAAGAAATTACACTTAGGaaaaaaaaaCACATCCCTCTCTCATGTCCTCTCCAGAGTAGGAGTGAAGAAGATCAGACTTAACCCCTACTGGATT
  5   1   2       bld Em10 5g3  in                    IMAGE:7982024.5p                                                                TCGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTAGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACTACTGTGCCACTGGAACAGACCCCAGAAAAGATCGATGAAACATGGCACAATCGATCTAGAGAAAATACACTTANGAAAAAAACACATCCTCTCTCATGTCTCTCCAAGTNAGATGAAGAGATCAGCTAAACCCTCTGAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980551.5p                                                                 CGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTAAAGGaaaaaaaaaaCACCATCCCTCATT
  5   1   2       bld Em10 5g                         IMAGE:8322315.5p                                                                 CGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAG
  5   1   2       chi Em10                            IMAGE:8318168.5p                                                                 CGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAAAGAAGACCGTCAAGCGGTGCCCGGGAGTTAGAGGTCCAGCCGAGGCCTCTTCCTATATCATCTTCACAGCGTTATAAAGAGGGAAATCACCACTCCTAATCACCTGATTAGTTCCCTAAAAACAATAAATATTCATGATTGCCAAGCCTGGATTCTCACTAATGGAATCTCACGTATTTGTGTTCCACGGGTA
  5   1   2       bld Em10 5x3                        IMAGE:8318759.5p                                                                 CGAGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCNATCGAATCTAGAAGAAATTTAAGG
  5   1   2       bld Ga18 5x3                           xlk60b10ex.5p                                                                   AGCTCAGNAGCACTATCACTCACACTGCAATCACAGCGCGATGNNTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCNNTNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCTATCGATCACGATGAGATGAGGTCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGNCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTNGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAANGNaaaaaaaaaCACCATCCCTCTTNTCCATGTCCCTCTCCAGAGTTAAGGNG
  5   1   2       bld Emb9 5x3                        IMAGE:7977822.5p                                                                    GCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAATTTACACTTAATGGaaaaaaaaaCACCATCCCTCTTCTCCATGGTCCCCTCTCCCAAAGTTAAGGAGTGAAGGGAAGAATCCAAGACT
  5   1   2       bld Ga18 5g                           xlk112n04ex.5p                                                                    AGCTCAGCAGCACTATCACTCACACTGCAATCACAGCGCGATNCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCNGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCTATCGATCACGATGAGATGAGGTCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGNCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTNAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTNAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGNAANNNNNCGATGAAANCNTGGCACCAATCGAATCTAGAAGAAANNACACTTAAGGaaaaaaaaaNNCNT
  5   1   2       bld Ga18 5g3  in                       xlk67m19ex.5p                                                                    AGCTCAGNAGCACTATCACTCACACTGCAATCACAGCGCGATGNNTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCGNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCTATCGATCACGATGAGATGAGGTCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGNCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGNCAGGGAGTTAGAGGTCCAGCCAAGGNATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATCGATGAAACCATGGCACCAATCGAATCTAGANGAAATTACACTTAAGGaaaaaaaaaaCACCATC
  5   1   2      seed Emb4 5x3               IMAGE:5537100-IMAGp.IMAGp                                                                        AGCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaa
  5   1   2       bld Emb4 5x3                        IMAGE:5537100.5p                                                                         GCAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGGCACTAAGGGAGCCCACCTACTGGGCCCACTGGAACAGACCCCCAGGAAAAAAATTCGATGAAACCATGGCCACCATCGAATCTAGAAGAAAATTACCCTTTAAGGaaaaaaaaaaaaCCCCTCCCTCCTTCTCCTGGCCCTCTTCCCGAATTAAGGGAGGGAAAGGAAAAATCCAAAAATTTAAAACCCCCCTACGTGGGGTTTTTCCGGGAAACCCGGGACCTTCGCCAAGGACTTGCGGAAATCCCggggggggTTATTTCCGGGTCCTACTTGGGGAATCTGTGGAA
  5   1   2       bld Ga18 5g3  in                      xlk133e23ex.5p                                                                         AGCAGCACTATCACTCACACTGCAATCACAGCGCGATGNNTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGNNNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGANNTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGNTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGNCATCCCCCAGGCAGCAGNAGNNCTTGTTAGNTAGCAGACAGCCCGAGNCCAGGGAAGAGGCACCCGTGGATANCGTGCGNANTGTGCCAAANCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGNGTTAGAGGTCCAGCCNAGGCATCANNTAACANA
  5   1   2       bld Emb9 5x3                        IMAGE:7977507.5p                                                                          CAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAGGAGAGTCAGACTTAAACCCACTACTGGAGTTTACTGAGATCGTGACCTCGCCAGGACTGCGGAATCGTGGGGTTAATCGGTTCTACTTGGGAATCTGAAAATTGTGC
  5   1   2       bld Em10 5g                         IMAGE:8317516.5p                                                                          CAGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTAGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAGATACTGAGTGCCCAGCCTGATGCCACTAAAGGAGCCCACCTACTGTGCCCACTGGACAAACCCCCAGGAAAAGATCAATGAAACATGGCCCAATCGAACTAGAGAAAATTCCCTTAAGaaaaaaaaaCCCTCCCTCTTC
  5   1   2       bld Ga18 5g3  in                      xlk127h23ex.5p                                                                          AGNAGCACTATCACTCACACTGCAATCACAGCGCGATNCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGNGNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGNCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGANCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGNATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTNCCAAGNCTGATGCCACTAAGGGAGCCCANCTACTGTGCCCNCTGGAACAGACCCCCNNNNAAANNNTCGATGAAACC
  5   1   2       bld Tbd7 5g3  in                         XL103p17.5p                                                                           GGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGG
  5   1   2       bld Tail 5x3                        IMAGE:8545759.5p                                                                           CGCACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACAATCGAATCTAGAAGAAAATACACTTANNGaaaaaaaaCACATCCCTCTCTCATGTCCTCTCCAGAGTAGGAGTGAAGAGATCAGACTAAACCACTACTGAGTTTCTGAATCGGACTCTCAGACGCGATCGTGGGTATCGTCACTGGATCGAATGGCACAGGACTCTGC
  5   1   2       bld Em10 5x3                        IMAGE:8317964.5p                                                                             CACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTA
  5   1   2       bld Ga18 5g3  in                      xlk113f16ex.5p                                                                             AGCACTATCACTCACACTGCAATCACAGCGCGATNCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCNGNGNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCNNNCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGANCGTCAAGCGGTNNCAGGGAGTTAGAGGNNCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACANACCCCCAGGAAAAAGATTCGANGAAANCATGGNA
  5   1   2       bld DMZ  5g3  in                         xl239m07.5p                                                                             CACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGAT
  5   1   2       bld Em10 5x3                        IMAGE:8318341.5p                                                                              ACTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTTAAGGaaaaaaaaaCACCATCCCTCTCT
  5   1   2       bld Tail 5x3                        IMAGE:8545407.5p                                                                               CTATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCCATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaaCACCATCCCTCTC
  5   1   2       bld Ga12 5g3  in                         XL194b22.5p                                                                                 ATCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCC
  5   1   2       bld Ga18 5g3  in                       xlk53n07ex.5p                                                                                 TATCACTCACACTGCAATCACAGCGCGATGNNTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCNGTCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCNAAGGAGAACGCAGAGAAGACCGTCAAGCGGTNCCAGNGAGTTAGAGGNCCAGCCNNNNNNTCAGCTAACACATCTACACAGCGTAGANAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTNNNACAGANCCCCAGGAAAAAGATTCGATGAAACCATGGCACNNATCGAATCTAGNAGAAAATTACAC
  5   1   2       bld Tbd7 5g3  in                         XL102g08.5p                                                                                  GCACTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAAC
  5   1   2       bld Ga18      in                      xlk121p14ex.5p                                                                                    TCACTCACACTGCAATCACAGCGCGATGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCNGNGNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGNAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGANCGTCAAGCGGTNNCAGGGAGTTAGAGGTCCAGCCAAGNNATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACNGACCCCCAGGAAAAAGATTCGATGAAANCATGGCACC
  5   1   2       chi Ov1                             IMAGE:8332541.5p                                                                                     CTCACACTGCAATCCCTTAGCGANGGCNNGATTCCACANCGCCCAGCAAGAAGACCTTTTATGAGCCCCAGCAGTGCAGCCCAGGATAACCGCCGGCACAGGGAGGGGAGCCCGCAGGAANCCGAGCGGTCTCAGCGATCACGAAGAGACGAGATCGGAGCAGAAGAGGCAACAGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAAGCAGCAGCAGCCCTTGTTTGTTTGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCACAGAACACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCGGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCAGCGATTATTTCCCTAAAAGACAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAAGGAGCCCACCTACTGTGCCCACTGGAACAGACCCGCAGGAGAAAGATTCGATGAAACCATGGCACCGATCGAATCTAGAAGAAAGTACACTTTAGGaaaaaaaaaaCACCATCCCTCTTCTCCTGTCCCTGTC
  5   1   2       bld Ov1  5x3                        IMAGE:8332157.5p                                                                                     CTCACACTGCAATCACAGCGCGATGGCTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAATTACACTTAGGGAAAAAA
  5   1   2       bld Em10 5x3                        IMAGE:8319909.5p                                                                                       CTCACCTGCAATCACAGCGCGATGGCTGCTTTCCCATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTAGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATCGATGAAACATGGCACAATCGATCTAGAGAAAATACACTTAAGGAAAAAAACACCTCCCTCTCTCATGTCCTCTCCAAGTAAGGATGAGGAGATCAGACTAAACCACTCTGAGTTTCTGAATCTGACTCTCAGACG
  5   1   2       bld Em10 5x3                        IMAGE:8318201.5p                                                                                         CTGCAAATCACAGCGCGATGGCTGCTTTCCAACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCATCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCCTCCTTATCACCGATTATTTTCCCTATAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAGGGGAGCCCACCTACTGTGCCCTCTGGAACAGACCCCCATGAAAAGATTCGATGAATCATGGCACCAATCGAAATCTAGAAAAAATTCCTCTTCATGaaaaaaaaaaaCACCTTCCCTTCTCT
  5   1   2       bld Ga18 5g3  in                      xlk127l17ex.5p                                                                                         CACACTGCAATCACAGCGCGATGNTGCTTTCCACATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGNGNGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGNTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCNCTGGAACAGACCCCCAGGAAAAAGATTCGATGAAA
  5   1   2       bld Em10 5x3                        IMAGE:7982787.5p                                                                                                 CACAGCGCGATGGCTGCTTTCCACATCGGCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCCATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGACACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCACAAAGGAGAACGCAGAGAAGACCGTCCAGCGGTGCCAGGGAGTTAGAGGTCCAGCCTAGGCATCAGTCTAACACATCTACACAGCGTAGAAAGAGGGAAGTCTCCACTCCTATCACCGATTATTTCCCTAAAAGAGAAAAGATACTGAGTGCTCACCCTGATGCCGCTAAGGGAGCCCACCTACTGTGCCCACGGGAACAGACCCCCAGCAAAAGATTCGATGAAACCATGGCACCATTTGATCCTGAAGAAATTAGCTGTAGaaaaaaaaGACTCATCCCTCTCTCCTGTCCTTTCCCAAGTTAAGAGTAAAGAATAGTCAGATTTAA
  5   1   2       bld Neu7 5g3  in                         XL049i01.5p                                                                                                   GCCTCGTGCCGGGCTGCTTTCCCATCGNCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAA
  5   1   2       bld Neu7      in                         XL043k03.5p                                                                                                               CTGCTTTCCCATCGCCCTGCAAGNAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTG
  5   1   2       bld Neu7      in                         XL043l02.5p                                                                                                               GCTGCTTTCCCATCGCCCTGCAAGAAGAAATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGC
  5   1   2       bld Ga18      in                      xlk146k19ex.5p                                                                                                                                 CTGNAAGAAGAAATGATCTCTGCCCCAGCGNNCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGNCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGATCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAANTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGNCAGGGAGTTAGAGGTCCAGCCAAGGNATCAGNTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAANTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGNNGNGAAGGAAGAGTCAAGACTTAAAACCNACTACTGGAGTTTTACTGAGATCC
  5   1   2       bld Tbd7                                 XL060l03.5p                                                                                                                                          GNATGATCTCTGCCCCAGCAGTGCTGCCCAGGTTATCCGCTGGCACAGGGAGGGGAGCCTGCAGGAATCTGTTCGGTCCCATCGATCACGATGAGATGAGGTCGGAGCTGAAGAGGCAACTGAAGGAAATCCAAGCGTCCGACTGTCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGGTAAGGTCCCTTGCTCATCACCAAAATACATATCTACATGATAACAAGG
  5   1   2       bld Em10                            IMAGE:7979173.5p                                                                                                                                                                                                                                                                        TCGGTCCGGATTCCCGGGATCAGAGGTGGAACTTTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCCGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAGGGAACCTCTGTGCTTCCCCTGTGGTGGCAACCAACAACGCTGCTGCAGAGATGAAATCGGTAAGTTGGGAGGCCATGATCTCATACACCGAGGCTTAATGTATTCAAATAAAAATAAGGAGGGGCGATAGTGGAGGGGGGCCCTCGGTTTATTGTGGAAGTACCGA
  5   1   2       bld Lmb1                            IMAGE:8536148.5p                                                                                                                                                                                                                                                                                                         TTGACTTTGAAACTGGCACCCCTCTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCAAGGACTGCGGAATCCGTGGGGTATTCGGTTCTACTGGGATCTGGAGTTTGTGCACAGGGATCTCGTGTGCTCCCTGTGGGTGCACATCACTGCTGCTGCCAATGACATCGTACGTTGAGTCACTATCTCTCACAGAGCTATTAATACTATTTTATAAAATGAGGCGAGATGCATGCGCCTCGGTTATGTGAGACGGACCTACTGCAGAACCTGCTCACTATAC
  3   1   2       bld Ga18 5g3  in                       xlk67m19ex.3p                                                                                                                                                                                                                                                                                                          ACTTTGACTTTGAANNTGGCNCCCCNNCTAAAGGGCATCTNTNNTGGNNNCCNTGNAGAGTAAANGATATGCCCAGNTCTNCANNCAGAACANAAGTATANCTGCNAACACANNGCCNTNCCCCAGGNAGNAGCAGNCTTNTNAGTTAGCAGACANNCCGANNCCAGGGNAGAGGCACCCGTGGATNCCGTGCGTAATGTGCCAANNCCTCCGTGNGCAAAGGAGAACGCAGAGAAGNCCGTCAANNGNTGCCAGGGAGTTAGAGGTCNNNNNAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCNCCNCTCCTATCNCCGATTATTTCCCTAAAAGAAAAAAGATACTGANNNNNANCCTGATGCCACTAAGGGANNCCNCCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGNNNNNAGCAGCACTCGGGGAGAACCTTNNCTNNNNNCCCNNT
  5   1   2       bld Ga18      in                      xlk104l02ex.5p                                                                                                                                                                                                                                                                                                                                CTAAAGGGCATCTTCTGTTGGGAACCCGTGGAGAGTAAAGATATGCCCAGTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGANAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACNNAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTNAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCNCCAAGGACTNCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGANTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCNACTATTCTNCATACAACCAGATGCTTTATATATATANC
  3   1   2       bld Ga18      in                      xlk139a22ex.3p                                                                                                                                                                                                                                                                                                                                                                               CCAGTTTCTANAGCCAGAACAGAAGTATAGCTNNCAACACAACGCCNNCCCCCAGNNANCAGCAGNCCTTNTTAGTTAGNAGACANNCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAANNGGTGCCAGGGAGTTAGAGGTCCANCNNAGGNATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGANNNNNANCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGNNNNNAGCAGCACTCGGGGAGAACCTTNNC
  5   1   2       bld Ga18      in                      xlk139a22ex.5p                                                                                                                                                                                                                                                                                                                                                                                 GTTTCTACAGCCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGNAGNCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatctcaatatatatatatatatatGAGGGGNNTGAATGAGTNGNCAGGGNGGNGCCCCCTCTGNNTTTTTAG
  5   1   2       chi Ga18                               xlk65c19ex.5p                                                                                                                                                                                                                                                                                                                                                                                           CCAGAACAGAAGTATAGCTGCCAACACAACGCCATCCCCCAGGCAGCAGCAGCCCTTGTTAGTTAGCAGACAGCCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGNCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGTGAGTACTGAACTGGGGTGGGGTTGCATGCAAATTTGATTGGCTGTCAGAGGGTGCTGGGAATATCGTCTTCACAAATTCCAAATATAGAGTAATAAGGGTTCNTGATTTGCACTACTGAAAACATAttttttttttATGTGGACATTGGCAGNTTTAAAAAGCAGATGTCAGTATAGATAAAGGGGTGGCAAGAGANAGCCCTAGACTGTGAGTTGGGTNCTGGAAATGATAGNTTTGTAGAACTGCAACTCCCAGCATTCTCTAAAGATGCTTGNCCATGNAGTNTAAAAAGGGTAACNTTTNNTTAAAATAGtttttttttttAAAANANCATTTTTTAANNG
  3   1   2       bld Ga18                             rxlk125l23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAGTTANNNNNNAGCCNGAGNCCAGGGNANNAGGNNCCCGTGGATNCCGTGCGTAATGTGCNAANCCCNCCGTNNNCAAAGNAGAACGCAGAGAAGACCGTCAANNGGTGCCANGGAGTTAGAGGTCCNNNCNAGNNATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGNNNNNANNCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCNCCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTNNNNANCAGCACTCGGGGAGANCCTTNNCNNNNNNCCC
  5   1   2       bld Tbd7      in                         XL094g01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGAGCCCAGGGAAGAGGCACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGCCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGT
  5   1   2       bld Ga18      in                      xlk127j10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGAGGNACCCGTGGATACCGTGCGTAATGTGCCAAACCCTCCGTGCGCAAAGGAGAACGCAGAGAAGACCGTCAAGCGGTGNCAGGGAGTTAGAGGTCCAGCCAAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGNTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatatctcaatatatatatatatatatatGAGGGGNNTGAATGAGNTGNNAGGGTGGCNCCCCCTCTGGGNTTTTTAGTGCTGTGAATNNTAACCGTGAAANAGCTTGAANCTNNNNNTCAGGGNNGAACTACCTATNGCT
  3   1   2       bld Ga18      in                      xlk127j10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGNAGANGNNCCGTGGATACNGTGNGNAATGTNNNNAACCCTNCNTGCGCAAAGGNGAACGNAGAGAAGACCNNCAAGNGGTGCNAGGGAGTTAGAGGTCNNNNNAGNNATCAGNTAANACATCTACACAGCGTAGAAAGAGGGAAATCNCCACTCCTATCNCCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTNNCAANCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATATCTCAATATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATTTTGTTGAATTACAGCTCCCAACGGAGTCGTNNNNANCAGNACTCGGGGAGANCCTTNNC
  3   1   2       bld Ga18 5g3  in                      xlk127h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGTGGATNCCGTGCGTAATGTNCNAANCCCTCCGTGNGCAAANNAGAACGCAGAGAAGNCNTCAANNGGTNCNAGGGAGTTAGAGGTCNNNNNAGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCNCCACTCCTATCACNGATTATTTCCCTAAAAGAAAAAAGATACTGANNNNNANCCTGATGCCACTAAGGGAGCCCNCCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCNCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGNNNNNAGCAGNACTCGGGGAGANCCTTNNCTNNNNNCCC
  3   1   2       chi Ga18      in                      xlk121p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNNNCCGTNNNTNATNNNCNAANCCCNNCGTNNNNAAAGNNGNACGNAGANAAGACCNNCNNNNNNNCCAGGGAGTTAGNNGNCNANNNANGGCATCAGCTAACACATCTACACAGCGTAGAAAGAGGGAAATCNCCACTCCTNTCNCCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTNNCAANCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCNCCAATCGAATCTAGAAGAAAATTACACTTAAGAAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTANNNAGCAGNACTCGGGGAGANCCTTNNC
  5   1   2       bld Ga18      in                       xlk77a01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACACATCTACACAGCGTAGANGAGGGAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatctcaatatatatatatatatatGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAANAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGNNNCGTAGCTCANCAGCACTCGGGGAGAACCTTAGGNTGAGCACCCC
  5   1   2       bld Lmb1                            IMAGE:8533668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATCACCACTCCTATCACCGATTATTTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGCACCAATCGAATCTAGAAGAAAATTACACTTAAGGaaaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatatctcaatatatatatatatatatatGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATTTTGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTANGCTGAGCACCCTGCTGTAGCTGTACAACCAGCAGACTGTACaaaaaaaaaaaCATATTGTACATTCAGTTGATATCCGATTGCCTGTTTGTTGTTGTTGTTCTTAAATGCACGTCTATCCCTATGTCGCACTGACTAGACTAAA
  5   1   0       add Neu7                                 XL006d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCCTAAAAGAAAAAAGATACTGAGTGCCAAGCCTGATGCCACTAAGGGAGCCCACCTACTGTGCCCACTGGAACAGACCCCCAGGAAAAAGATTCGATGAAACCATGGTGAGTACTGAACTGGGGTGGGGTTGCATGCAAATTTGATTGGCTGTCAGAGGGTGCTGGGAATATCGTCTTCACAAATTCCAAATATAGAGTAATAAGGGTTCCTGATTTGCACTACTGAAAATGttttttttttttttttNTGGGG
  5   1   2       bld Lmb1                            IMAGE:8535287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCCCCTTGTGTGTGTATGTGTAGTAGTACACGCCACCGATTGTCCACTTGCTTTCCACGGTCCTAACCTTGTAATTTCTTATTTAttttttttaggcaccaatcgaatctagaaaaaaattaaacttaaggaaaaaaaaCACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGGGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatctcaatatatatatatatatatGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTGTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACGGCTCCCAACGGAGTCGTAGCTCGGCAGCACTCGGGGAGGACCTTAGGCTGAGCACCCTGCTGTAGCTGTACAAACAGCAGACCTGTACaaaaaaaaCAACAATATTGTACATTCAGTTGTATATCACGATTGCCTGTTTTTTGTTGTTGTTCTTTAAATGCACTGTTATTACACCTATGTCACAACTGTACTAA
  3   1   2       bld Ga12 5g3  in                         XL194b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGGAACAGACCCCCNGGAAAAAGATTNGATGAAACCNTGGCCCCNATNGAATTTAGAAGAAAATTNCCCTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTGTACAAACCA
  3   1   2       bld Ga18      in                      xlk146k19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANNCCCCNANGAAAAANNNTNGANGNANNCATGGCNCCAATCGAATCTAGNANNAAATTANNCTTAAGNAAAAAAAAACNCCNTNCCTCTNTCCATNNCCNTCTCCNAGAGTTAAGGAGTGANNGNAGAGTCAAGNCTTAAACCCACTACTGGAGTTTTACTNAGATCCGTGNNCTCNCCAAGGNCTGCGGAATCCGTGGGGTTATTCGNTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGNAANCCATCCAACTNNTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCATAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATNCCAAGTTGNNAAAAANNA
  3   1   2       bld Neu7      in                         XL043k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGGACAAACCAGCAGACCTG
  3   1   2       bld Neu7      in                         XL043l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGAAGAAAATTACACTTAAGGAAAAAAAAAACACCATCCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGGACAAACCAGCAGACC
  5   1   2       bld Ga18      in                      xlk158l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTCTTCTCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCGCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatctcaatatatatatatatatatGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGNTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGNCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACaaaaaaaaaa
  3   1   2       bld Tbd7                                 XL099j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCATGTCCCTCTCCCAGAGTTAAGGAGTGAAGGAAGAGTCAAGACTTAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACACGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGNTGAGCACCCC
  3   1   2       bld Ga18      in                      xlk158l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNTNCATNNCCTCTNCCAGAGTTAAGNAGTGAAGGAAGAGTNAAGNCTNNAAACCCNCTACTGNAGTTTTACTGAGATCCGTGACCTCGCCAAGGNCTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCANCTGCTGCTGCACGAGATGCACANTCTGTAACGTTTGGATGTCCAACTATTCTCCATACANCCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATNTNCCAAGTTGNCAAAAANCAACG
  3   1   2       bld Ga18      in                       xlk77a01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNTNCCTNNCCNAGAGTNANGGNNTGAANGNANNAGTCAAGNCTTAAANCCNCTNCTGGAGTTTACTNAGNTCCGNGNCCTCTCCAAGGNCTGCGGAATCCGTGGGGTTATTCGNTTCTNCTTGGGATCTGGAGATTGTNNCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAANCCATCCAACTGCTGCTGCACGAGATGCNNAATCTGTAACGTTTGGATNNCCAACTATTCTCCATACANCCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGNGCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATNNNNAGAATNNNCCAAGTTGNNAAAAAACAA
  3   1   2       add Ga18 5g3  in                      xlk127l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAANGNAGANNCAAGNCTTAAANCCCNCTACTGGAGTTTTACTNAGATCCGTGNCCTCGCCAAGGACTGNGGAATCCGTGGGGTTATTCGGTTCTNCTTGGGATCTGGAGATTGTGCCAAAAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAANCCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCANCTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCTCTGGGTTTTTTAGTGCNNTNNNTNTTNNNNGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCNCCAGATGTCGTTGAATTACAGCTNNCNNNGGNNTNGTAGCTCAGCAGCNCTNNNGGAGAACCTTAGGCTGAGCNCCCCTG
  5   1   2       bld Ga18                              xlk139k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNNAAAACCCACTACTGGAGTTTTACTGAGATCCGTGACCTCTCCAAGGACTGCGGAATCCGTGGGGTTATTCGGTTCTACTTGGGATCTGGAGATTGTGCCAACAAGGGACTCTCGTGTGCTTCCCCCTGTGGTTGCAAACCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTtatatatatatctcaatatatatatatatatatGAGGGGGCTGAATGAGTTGGCAGGGTGGNNCCCCCTCTGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACaaaaaaaaaaaaaaaCAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACtgttttgtttgtttgtttgtttcttttAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGaaaaaaaaaa
  3   1   2       bld Unk4                                726_17J01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCTCGCCAAGGATTGCGAAACCGTGGGGTATTCGGTCAGACTGGGATCTGAAGATTGTGCCAAAAAGGGACTTTCGGTGGGCTTCCCCCTGGGGTTGCAACCCATCCAACTGCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATAGATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTATGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAACCAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACCAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATAT
  3   1   2       bld Ga18      in                      xlk104l02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCNCCAAGGNNNNCGGAATCCGNGGGNTTANNNNGGTNCTNCTNGGGATCTGNAGNNNTNCNAAAAAGGGACTCTNGTGTNNTTCCCCCTGTGNTTGNAANCCATCCAACTNCTGCTGCNCGAGATGCACAATCTGTAACGTTTGGATGTCCAACTATTCTNCATACANCCAGATGCTTTATATATATnTCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGNGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGANCCTTAGNCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTANAGAATNNNCCAAGTTGNNAAAAANCANCNT
  3   1   2       bld Ga18 5g3  in                      xlk113f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTNGGGTTANTCGGTNCTNCTNGGATCTGNNGATNGTGCNAAAAAGGGACTCTCGTGTNCTTCCCCCTGNGGTTNCAAACCATCCAACTNCTGCTGCACGAGATGCACAATCTGTAACGTTTGGATGNCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATNNNCCANNNNNNAAAAA
  3   1   2       chi Ga18 5g3  in                       xlk53n07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNAAAAGGGANTCTCNTGTNCTNNCCCCTGTGGTNNNNNNNCATCCAANNTGCTNCTGCNNGAGANGCACNNTCTGTNNNGTTTGGATNNCCAACTNTTCNCCANANANCCAGATGCTTTANATATATATCTCnATATATATATAnATATANNAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCNCCTCTGGNNNTTTTAGTGCTGTGAATNTTANCCGTGAAACAGCTTGANTCTATNGCTCAGGGATGANCTNCCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCANCAGCNCTCGGGGAGANCCTTAGGCTGAGCACNCCTGCTGTAGCTTGTACAANCCAGCAGANCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCNCGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATNNNCCAAGNNG
  3   1   2       bld FaBN      in                    IMAGE:8076201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGACTCTCGTGGCTTCCCCCTGTGGTTGCAAACCATCCAACTGNTGCTGCACGAGATGCACAATCTGAAAAGTTTGGATGTCCAACTATTCTCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGCTAATATACCACACTAATGTACAGCCAACATGTCACATAAGAGCGCAAAAAAGAATTCATAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCCGCCACAATCATGGCTAAGAAACACAAACATGTTTTTTTGATAGATGCTATACTATACCTTTATGTATCCCTACGAGAGTAAAACATCAAACTAAAAAACAAGTATGCGTTCCTTAACCAGGCATGTACCGTCTCATATATAACGTATACAAATAAAAAAATATATATTTTTCTTTGACATTCACAAAACACACAATATGACATGTTGCTGACATAGTGTGATGATATGTTTTT
  3   1   0       chi Em10 5g3  in                    IMAGE:7980551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTGTGTTCCCCAGAGAGACCAAATTTGTAAATTTTTGAATTTCCAAATATTTTCCCACACAACACAGGGGTTTTAATATATATATTCCCAAATTATTTAATATTATAAATATATTAATTTGGGGGGGGCTGAATAGAGTTGGCAGGGGGGCGCCCCCTCTGGGGTTTTTAGTGGTGGAAATGTTAACGTGAAACAGCTTTGAATTTATTGGTCAGGGGAGGACTACCCTAGGGCTCTCCAGATGTGGTTGAATTACAGCTCCCAAGGGAGTTGGTAGCTCAGCAGCCACTCGGGGAGAACCTTAGGCTGAGCACCCCCTGCTGTAGCTTGTACAACCCAGCAGACCTGTACAAAAAAAAAAAACCAATATTTGTAGCAATTTCAGTTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTGTCTTTTAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATATATAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGCAATATTGCCAAGTGGCCAAAACACAACGTAAAAAAATAAGGAAA
  5  -1   0       chi Bla2                            IMAGE:7300455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTTCGTCATGGATTGAATGGCACAGGATTGTGTGTCCCTGTGTGCACCATCACTGTGTGCCGGAGCACATTGTANGTGGAGTCCACTATTCCATCACCAGAGTATAATTCTCAATTATATTAATACAATAATATGAGGGGCTGAAGAGTGGCAGGGTGTGCCCCTTCTGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGGACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACaaaaaaaaaaaTAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGaaaaaaaaaCGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTaaaaaaacaaagtaaaaaaaaGTATGCGTTCCTTAACTATGCATGTACAGTCCTCtatataattatatatataaaaaaatatctattTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTTGGCAAAAAACAAAGTAAAATCTAAGACTTTTATATCATaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGACGG
  3   1   2       add Em10 5g3  in                    IMAGE:7982024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTTGCTCCGAGATGCACAATATGTAACGTTTGGATGTCCCAACTATTCTCCATACAACCCAGAGGCTTTATATATATATCTCACTATATATATATATATATGAGGGGGCTGAATGAGTGGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTACCCGTGAAACAGCTTGAATCTATTGCTCAGGGATGAACTATCTATGGCTCTCCAGATGTGGTTGAATTACAGCTCCCAACGGAGTTGTAGCTCTGCAGCACTCGGGGAGAACCTTAGGGTGAGCACCCCTGATGTAGATTGTACAAACCGGCAGACCCGTACAAAAAAAAAAAAAACCAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAAAAATGTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAAATAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGACTATGCCAGAGCACACAAAACCAGCGTTCAACCTAAACC
  5  -1   2       bld FaBN      in                    IMAGE:8076201.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGGAGCCATCTGAAGTTGGTTCAACTTCTCAACAACAGAGCTTAATTATTTCAATAATTATATTAAGAGGGGGTGAATAGTGGCAGGGGCGCCCCTCTGGGTTTTTAGTGCTTGAATTTACCCTGAAACAGCTTGATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACaaaaaaaaaaaaaaaCAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACtgttttgtttgtttgtttgtttcttttaAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGaaaaaaaaatatgttttttttATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTaaaaaaacaaactaaaaaaaaaGTATGCGTTCCTTAACTATGCATGTACAGTCTTCtatataattatatatataaaaaaatatctattTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTTGGCAAAAAAACAACGTAAAATATAAGACTTTTTCTCCaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCATACAACCAGATGCTTTATATATATATCTCAATATATATATATATATATGAGGGGGCTGAATGAGTTGGCAGGGTGGCGCCCCCTCTGGGTTTTTTAGTGCTGTGAATGTTAACCGTGAAACAGCTTGAATTTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACGGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAA
  5   1   2       bld Ga18                              xlk133l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGNNCNGCTTGAATCTATTGCTCAGGGATGAACTACCTATGGCTCTCCAGATGTCGTTGAATTACAGCTCCCAACTGAGTCGTAGCTCAGCAGCACTCGGGGAGAACCTTAGGCTGAGCACCCCTGCTGTAGCTTGTACAAACCAGCAGACCTGTACaaaaaaaaaaaaaaaCAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACtgttttgtttgtttgtttgtttcttttAAAAATGCAACTGTTAATATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGaaaaaaaaaaaTGTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTaaaaaaacaaactaaaaaaaaaGTATGCGTTCCTTAACTATGCATGTACAGTCTTctatataattatatatataaaaaaatatCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTTGNNAAAAAAACAACGTAAAATATAAGACTTTTATATCaaaaaaaaaa
  3   1   2       add Ga18 5g3  in                      xlk133e23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCTTGANTCTATNGCTCAGGGATGANCTNCCNNTGGCTCTCCAGNTTTNNTTNAATNACAGCTNCCANNGGANTCGTNGNTCANCAGNNCTNGGGGAGAACCTTAGNCTGAGCNCCCCTGCTGTAGCTTGTACAAACCAGCAGNCCTGTACAAAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTNCTATNCCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATNCTGGCTACGAAAAAAAAAAATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATATAAAAAATATCTATTTTTCTTTTGACTTTNANAAATGTACAGAANNNNCCAAGTTGNCAAAAAACAAA
  3   1   2       bld Neu7 5g3  in                         XL049i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNNTCAAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCATAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTGGCAAAAAACAACGTAAAATATAAGACTTTATAGC
  3   1   2       bld Tbd7      in                         XL094g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCNCACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACANATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAAATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATATAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATTGCCAAGTGGCAAAAAACAAAGTAAAATATAAGACTTTTA
  3   1   2       bld Tbd7 5g3  in                         XL102g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGTATAATCACGATTTGCACTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCACACTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGACTCCAATGTTCAGCCATAATACTGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTAAACTTTTACAAATGTACAGAATATTGCCAAGTGGCAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl239m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCNAAAAAAAAAAACNATATTTGTAGCATTTCAGTTTGTATAATCCCGATTTGCNCTGTTTTGTTTGTTTGTTTGTTTCTTTTAAAAATGCAACTGTTACTATACCNCNCTAATGTACAGCAAACATGTAACATAAGAGCGTAAAAAAGAATTACTAAGTTATATATTTATATAACATATTGGAACGNCTCCAATGTTCAGCCATAATACNGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTATATATACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAATATCTATTTTTCTTTTGACTTTTACAAATGTACAGAATATGC
  3   1   2       add Tbd7 5g3  in                         XL103p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAAAAAAAAACAATATTTGTAGCATTTCAGTTTGNATAATCNCGATTTGCNCTGNTTTGTTTGNTTGTTTGTTTCTTTTAAAAANGCAACTGTTACTATACCNCACTAATGNACAGCNAACATGTAACATAAGAGCATAAAAAAGAATTACTAAGNTATATATTTATATAACATATTGGNACGACNCCAATGNTCAGCCATAANACNGGCTACGAAAAAAAAATATGTTTTTTTATAGATGCTANANANACGTTTATGTCTCCCTTGGAGAGTAAAAAAACAAACTAAAAAAAAAAGTATGCGTTCCTTAACTATGCATGTACAGTCTTCTATATAATTATATATATAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)