Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL211a01.5                           36 PI      90         30     1200                novel protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 88%

 1012768026 Xl3.1-IMAGE:6866163.5 - 81 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6866163.5                                                      TCAAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCTTTTTTTATTTAGCATTTTTCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGGCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTT
                                                  Xl3.1-CHK-1012685833                                                            AGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCTTTTTTTATTTAGCATTTTTCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGGCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAAT
                                                      consensus depths                                                           3     4     5     9    15    19    24    26    27    30    28    30    27    30    29    31    29    31    29    31    29    31    31    33    31    33    31    33    32    34    32    34    32    34    32    34    32    34    31    34    30    33    31    33    31    33    30    34    30    34    33    34    32    34    32    34    32    34    32    34    32    34    32    33    32    33    32    34    33    34    33    34    31    32    30    32    31    32    31    32    30    31    29    30    30    31    30    30    30    30    30    30    30    30    27    28    25    26    21    24    20    24    19    22    20    23    20    23    19    22    16    20    16    18    14    16    13    17    13    16    13    15    10    14     9    11     9    11     8    11     6    10     6     9     6     9     6     9     6     8     5     7     4     7     5     8     5     8     5     8     5     6     5     6     5     5     5     5     5     5     5     6     5     6     5     7     5     7     5     7     5     7     4     7     4     7     5     7     4     7     5     7     4     8     4     8     4     7     4     8     4     8     3     8     4     8     4     8     5     9     5     9     4     8     4     8     4     8     7    11    10    14    11    13    11    14    12    15    17    22    16    22    18    23    18    25    21    27    25    30    26    31    28    32    30    34    29    34    30    34    31    35    32    35    32    35    32    36    31    36    31    37    32    38    33    38    33    38    35    38    36    38    36    38    37    38    37    38    37    38    38    38    38    38    38    38    38    38    38    38    38    38    40    41    41    41    41    41    41    41    41    41    40    40    38    38    38    38    33    38    33    38    32    38    32    37    31    37    31    37    30    37    30    37    30    37    30    37    30    37    30    37    29    36    28    35    28    35    20    31     9    14
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTG
                                                                   SNP                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                               BLH ATG      23     266                                                      
                                               BLH MIN      23      71                                                      
                                               BLH MPR      23      71                                                      
                                               BLH OVR      23      19                                                      
                                               EST CLI       9      38                                                      
                                               ORF LNG      23       5                                                      
                                                                                                                                                   PREDICTED = Dr ==== 1e-084     NP_991150.1 hypothetical protein LOC402846 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                   PROTEIN === Xt ==== 0          CAJ83397.1 novel protein [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                   PREDICTED = Xl ==== 0          NP_001121223.1 hypothetical protein LOC100158295 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6866163.5                                                                             ATG------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG------------------------------------------------------------------------------------------TAA------------ATG---------------------------------TGA------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------TGA---------------------------ATG------------------------TGA------------------------ATG---------TAA------------------------------------------TAG------------TAA------TAG---------------------------TAA------------------ATG------------ATG---------------------------------TGA---------------ATGTAA
                                                                   ORF                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       chi Tbd3                            IMAGE:3549595.5p GGAAAANTNNGTTTNCTTCTTTGGGGNNNAGGCAAANACACGTTGNGACACATNCCGGCATCNCCGNNGNACAGAAAAACAACANCTTTTNTTGGTTTTCTTGTTTCGGGGGAGCATGTTCAGATAACACCCCGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAACGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCGGAGGGCGGTGTTCCCCATTGATTAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGaaaaaaaaaaGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGAATGCATCAGAATGCCATTTCTGAAGA
  5   1   2       bld Emb1 5g                         IMAGE:6630996.5p                              CCACGCGTCCGCGGACGCGTGGGTTCAAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGAACTCCTGGTGTTCCCCAACTAAATTTGACACCTGTGGGTTGTTGAAAAGCCCAAATGGGAGCGGAAATTGTGCAGACCTGTGGGAAAATTGTGAAAATGAAAAGAGAACTGGTTACCGAATCAAGCTTACCTGGGATAATTACTATGGAAGTAGTGGTACCATTCCTAATGGGCAGNCAAAGAAGGAGAAGGGGTAAAAGGGAAAATGGATGCTAAGGAAGGTGGCCTTAGGGAGGGCTGGTN
  5   1   2       bld Ga15 5g3  in                       XL457o15ex.5p                                                   CTTTCAAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGC
  5   1   2       bld Ga15 5g                            XL481b02ex.5p                                                    TTTCAAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCA
  5   1   2       bld Neu1      in                     Neu1-25H12-1.5p                                                         AACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAATAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCC
  5   1   2       bld Emb1 5g                         IMAGE:6866163.5p                                                             GGACGCGTGGGCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAATCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGGAAGAAGGTGCTTAAGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTA
  5   1   2       bld Ga18 5g3  in                      xlk134h16ex.5p                                                               GAGAAGNNATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTNGGCTTGCANNNNNTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGNGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGNTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTNCCGAATCAGCTACCTGGAATATTACTATGAAGNA
  5   1   2       bld Ga18 5g3  in                      xlk148i02ex.5p                                                               GAGAAGNNATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGTGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTNGGCTTGCANNNNNTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGNNTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAANATTACTATGAAGNAGTNTACNATTCTAATGGCAGNAAAGAGGAGAGGGNAANGGAAANTG
  5   1   2       bld Emb1 5g3  in                    IMAGE:5154822.5p                                                                  AGGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGGAAAGTGTTCCCAGTCCTACAAAGACCACAGGACTCCCTGTGTTCCCCAACTAAATTTTGACACTGTGGGTGGTTGAAAGCCCAAAGGGAGCGGGAAATTGGGCAAGACTGTGGGAAAATTGGGGAAAGGAAAAGAAGAACTGGTAACCGAAATCAGCTTACCTGGGAAATATTACTTTGGAAAGTAGGTGGTCCCCCTTTCTAATGGGCCGGCCAAAGAAGGAAAAGGGGAAAAGGAAAATTGGATGTTAGGGAAGGCGGCCCTTAGGGAGGTTGGTTCCTCCGGGGAAAGCCCTTTGGGCCAACCCGGGGGATTTCCCGGGAAATCCGGAGAACCCCTT
  5   1   2       bld Emb1 5g                         IMAGE:6630873.5p                                                                   GGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAATCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAAGGTGCTTANGAGGCTGTTCATCAGGAAAGCCTTGTCCTACTCAGGGATTCCCGTACAGAGATCCTTTGTATTAGTGTGGGCACAAAGCTCCGGGCCATGGGATGGGTCCCCTCCCAGAATACCGAGAAccccccccTTTC
  5   1   2       bld Emb1 5g                         IMAGE:6633478.5p                                                                   GGCATCAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAATCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTANGAAGGTGCTTAGGAGGCTGTTCATCAGGGAAGCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTTGTATAAGTGTGGGCCAGAAAGCTCGGGGCAATGGATGTGGTCCTC
  5   1   2       bld Neu7 5g                              XL028a07.5p                                                                      GCAGACATGGNAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGTGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGCACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACC
  5   1   2       bld Neu7 5g3  in                         XL035e15.5p                                                                      GCAGACATGGNAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAG
  5   1   2       bld Ga12 5g3  in                         XL159i19.5p                                                                      GCAGACATGGNAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTC
  5   1   2       bld DMZ  5g3  in                         xl221i18.5p                                                                        CAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAAT
  5   1   2       bld DMZ  5g3  in                         xl310j14.5p                                                                        CAGACATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAA
  5   1   2       bld Ga12 5g3  in                         XL201o09.5p                                                                            CATGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCANAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTANGAAAGTGTTCCANTCCTACA
  5   1   2       bld Ga12      in                         XL207c12.5p                                                                              GCACGAGGCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTANGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAA
  5   1   2       bld Ga12      in                         XL215g21.5p                                                                              TGGAACATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAGAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAANTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAA
  5   1   2       bld Ga12      in                         XL141m19.5p                                                                                  GNATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAA
  5   1   2       bld Ga12      in                         XL189b01.5p                                                                                    ATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGGACTCCTGTGTTCCCCAACTAAATT
  5   1   2       bld Ga12      in                         XL190b01.5p                                                                                    ATCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACNAAG
  5   1   2       bld Ga12      in                         XL156a02.5p                                                                                     GCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGACAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAG
  5   1   2       bld Ga12      in                         XL180k19.5p                                                                                     TCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCATGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGT
  5   1   2       bld Ga12      in                         XL208i22.5p                                                                                     TCTTTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACATGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAA
  5   1   2       bld Neu7      in                         XL038l15.5p                                                                                        GTTCTTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAAC
  5   1   2       bld Ga12      in                         XL195b22.5p                                                                                            GAGGTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACT
  5   1   2       bld Ga12      in                         XL197l22.5p                                                                                            TTGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGT
  5   1   2       bld Ga12      in                         XL183c18.5p                                                                                             TGTTTTTCTTGTACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCT
  5   1   2       bld Ga12      in                         XL192g08.5p                                                                                               GGTTTTCTTGACCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTG
  5   1   2       bld Ga12      in                         XL164c15.5p                                                                                                                                CATTTTGCTGCCTATGGTAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGTTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTC
  5   1   2       bld Ga12      in                         XL206c12.5p                                                                                                                                                                                AATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCACAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCC
  5   1   2       bld Ga12                                 XL210c12.5p                                                                                                                                                                                  TCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCANAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGG
  5   1   2       bld Emb1                   IMAGE:6630873-IMAGp.IMAGp                                                                                                                                                                                                                          TTGGTTTATATTGGACAAGATATCTCTGGTAGTCCAGTAAGTGTGGATGTTGGACTGTGCAGGTCTCATTGCGGTGTTCCCCAAAGAATAAATGCGTACAATCAGGCATTGCCTGGGCTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGCCAATCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCCACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGACCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGGAATCAGCTACCTGGAA
  5   1   2       bld Ga12      in                         XL176j19.5p                                                                                                                                                                                                                                                                                                                                  AGGCATTGCCTGGGCTTGCAAAGCATTCTTCCTGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCAAATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAAGAGTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTT
  5   1   2       bld Tbd7      in                         XL071g04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTACACCTGTCAACCCACCAAAGTTGGGATTGAAAGAGTCCTGTTATTCCAGGGAATCCAAGAAGTGGAGGTGATAGAGGACTGCCAGTGCAGCCTGATTCCAGAAGATTGCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCtttttttatttagcatttttCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAAT
  5   1   2       bld Ga12                                 XL154f03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATCAGAATGCCATTTCTGAAGACATTTTTTCCAGATTCTCCCTTTGAATCAACAGTGGATGTAGGAAAGTGTTCCAGTCCTACAAAGACCACAGGACTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCtttttttatttagcatttttCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGT
  5   1   2       bld Ga12      in                         XL209d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTGGTTGTTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCtttttttatttagcatttttCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAG
  5   1   2       bld Ga15      in                       XL442l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTTACCGAATCNGCTACCTGGAATATTACTATGAANTANNGNACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCAGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGANCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTANAGAAACATTCtttttttatttagtattttttGACTAGGAATTTTCTATCTAGTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACAAGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTANTGGTCAATAATGGCCTTTTANGTTTTGAGGTTTTGGGGTTCAAANACTATCCTG
  5   1   2       bld Ga12      in                         XL158a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCtttttttatttagcatttttCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGGCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTC
  3   1   2      seed Ga18 5g3  in                      xlk134h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAGNCCNGCAAGTNNNNAATGNNNNNAAANNTTCNTTTTTTATTTAGNNTTTTTCAATCTAGTAGNTTTCTATCNNCTGNAAANTATGGNANTNCNACAATTAAACTAGTTNCCTAAGNACTNTCATCAATGGTACTGANCTGNAGNTTCTCTGCTNCTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTNNCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGNCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGA
  3   1   2       bld Ga18 5g3  in                      xlk148i02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTNCNAAATGNNNAGAAACATTCTTTTTTNNTTAGTNTTTTTTGNCTANGANTTTTCTATCTAGTGAAAAATATGGAATTGCTACAATTAANCTAGTTACCTAAGNACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAATGNAGAAAAGGNCACTTTAATTCTCTTTAAAATGTGCCTACAAGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGNCCTTTTAGGTTTTGAGGTTTTGGGGTTCAAAGACTATCCTGTGCAAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGCTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTAACAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAAAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCTAATATGTTGCAAACTAAAAGCACATTTATCTGAATCCCAAATGATATTCTGCCTTCAATGCAGCCCATTTAAAAAGAAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAAATATATGTTGTCAAG
  5   1   2       bld Ga15      in                       XL518b09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATATGGAATTGCTACAATTAAACTAGTTACCTAAGCACTGTCATCAATGGTACTGAGCTGCAGATTCTCTGCTACTTTTTGGTGAAGAAAAGGGCACTTTAATTCTCTTTAAAATGTGCCTACATGTCTGGCACAAGGATTAAAATACCCCTACATAAATGGTTATCATTGCTTAGTGGTCAATAATGGCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTC
  3   1   2       chi Neu1      in                     Neu1-25H12-1.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGAAAGCCCAAATGGAGCGGAAATTGTGCAGACTGTGGAAAATTGTGAAATGAAAGAGAACTGTTACCCGAATCAGCTACCTGGAATATTACTATGAAGTAGTGTACCATTCTAATGGCAGCAAAGAGGAGAGGGTAAAGGAAATTGATGTAGGAAGGTGCTTAGGAGGCTGTTCATCAGGAAGCCATTGTCTACTCAGGGATTCCCGTAACAGAGATCATTGTATAGTGTGGGCAGAAGGCTCGGGCAATGGATGTGTCCCTCAAGATTACGAGACACACACATTCAGGAGCAGGAATGGACACATACGTTCTGTGTTTGGCAATCAAGACCTGCAAGTGCCAAATGTAGAGAAACATTCTTTTTTTATTTAGCATTTTTCAATCTAGTAGATTTCTATCTACTGAAAAATATGGAATTGCTACAATTAAACTAGTTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTT
  3   1   2       bld Emb1 5g3  in                    IMAGE:5154822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGGCACTTTAATTCTCTNTAAAATGTGCCTACATGTCTGGCACAAGGATTTAAAATACCCCCTAACATAAATGGTTATCATTGCTTAGTGGTCAATAATGGCCTTTTAGGTTTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTT
  3   1   2       bld Ga15      in                       XL518b09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACATAAATGGGGTATCATNGGCGTNGGGGTCAATAAATGGCCTTTTAGGGTTNTGAGGGTTTTGGGGCTCAAAGACTATCCCTGNGCGAGGACATATTTTTTATGGNGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTG
  3   1   2       bld Ga12      in                         XL164c15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGAT
  3   1   2       bld Ga12      in                         XL215g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGAGGTTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATAT
  3   1   2       bld Ga12      in                         XL192g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTGGGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATNTGTCAAG
  3   1   2       bld Ga12      in                         XL208i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTGTCAAGAT
  3   1   2       bld DMZ  5g3  in                         xl310j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATAT
  3   1   2       bld DMZ  5g3  in                         xl221i18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAAAGACTATCCTGTGCGAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACGGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATG
  5  -1   2       bld DMZ                                  xl306c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCTGTGCAAGGACATATTTTTTATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGCTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTAACAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAAAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCTAATATGTTGCAAACTAAAAGCACATTTATCTGAATCCCAAATGATATTCTGCCTTCAATGCAGCCCATTTaaaaagaaaaaaaaGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAAtatatactgtaaaacaaatagttgtacatttgtatatattattgtatataagatttgtatatacTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACC
  3   1   2       bld Ga12                                 XL218j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATTGTGAGGTCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGAT
  3   1   2       bld Ga12      in                         XL180k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATAT
  3   1   2       bld Ga12      in                         XL197l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACNGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATAGGTGTCAAG
  3   1   2       bld Ga12                                 XL188p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATNTGTCAAG
  3   1   2       bld Ga12      in                         XL183c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTCAAGCAACTATATCTTATATCTTTCTATATAATTTTACGGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAAT
  3   1   2       bld Ga12      in                         XL195b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACNGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGANTTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTNNCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATAGGTGTCAAG
  3   1   2       bld Ga12 5g3  in                         XL201o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACTCAAGCAANTATATNTTATATNTTNTATATAATTTTACNGTAGTNGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGA
  3   1   2       bld Ga12      in                         XL207c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTCAAGCAACTATATCTTATATCTTCTATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAG
  3   1   2       bld Neu7 5g3  in                         XL035e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATATAATTTTACTGTAGGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCANATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCGAAATAAA
  3   1   2       bld Neu7      in                         XL038l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATAATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAAT
  3   1   2       bld Ga12 5g3  in                         XL159i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTTTACTGTAGTTGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAAT
  3   1   2       bld Ga12                                 XL216h03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTACTTGAGAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAATGA
  3   1   2       bld Ga12      in                         XL209d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGAAGTTCCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATNTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAAT
  3   1   2       bld Ga12                                 XL160i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTTCCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACANTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTNTGAGAATTTNTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGNATATATTATTGTATATAAGATTTGTATATACTGNACATGCAACCAATTGAAATGTTTTTATTAAANTCCAATATTTATAT
  3   1   2       bld Ga12      in                         XL158a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTACAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGCATTTTTGCAACATAAAAT
  3   1   2       bld Ga12      in                         XL176j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTGTCAAGATTTTGCAAATAAAAT
  3   1   2       bld Ga12      in                         XL156a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGTTTAAAAAGAACATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTNGTCAAGATTTTGCAAATAAAAT
  3   1   2       bld Ga12      in                         XL141m19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTACCAAAGCACCATTTGTACATAGACACTTGGGCATGGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGT
  3   1   2       bld Tbd7      in                         XL071g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCATTTGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTGTCAAGATTTTGCAAATAAAATNA
  3   1   2       bld Ga12      in                         XL189b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTNGTACATAGACACTTGGGCATAGAAATACAACTCATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAG
  3   1   2       bld Ga12      in                         XL190b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCAATTGATTGAATCTGGAAGTTTGTATTTGACTTAATACAAAATGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAAT
  3   1   2       bld Ga12      in                         XL206c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAAATGCTTCAAANCAGATTTTTCCAAAATACAAAATCTGTACCAGTNCCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTAGTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTNTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATNGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATANGTTGTCAAG
  3   1   2       bld Ga15      in                       XL442l08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATACAAAANGCTTCAAAACAGATTTTTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACNAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCTAATATGTTGCAAACTAAAAGCACATTTATCTGAATCCCAAATGATATTCTGCCTTCAATGCAGCCCATTTAAAAAGAAAAAAAAGTATTTTGGTCTTTGGTATNAAGCTATACTATAGAAATATATACNGTAAAACAAATAGTNGTACATTNGTATATATTATNGTATATAAGATTNGTATATNACTGTACANGCAACCAATNGAAANGTTTTTATTAAATTCCAATATTTATATAGATGACNGAATACCATATAAAAGCATGTAAATAAAATATATGTGTCNAGATT
  3   1   2       bld Neu7                                 XL015p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCAAAATACAAAATCTGTACCAGTACCATTTTAAATCTGAGCACAAACATCAAACAGCATTGTCTGAGAATTTCTAAGATTCCTATTGTCCAGTTCTACTAGGGCTCTGGCACAAATGATATTCCAAAACCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAACAACAAATAGTTGTACATTTGTATATANTANTGTATATANGATTTGTATACACTGTACATGCAACCAATTGAAATGNTTTTATTAAATTCCAATATTTANATAGATGACTGNATACCATATAAAAGCATGTAAATAAATATATGTGGCAAGATTTNGCAAATAA
  3   1   2       bld Ga15 5g3  in                       XL457o15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AANNCAAAATCTGTNCCAGTACCATTNTTAAATCTGAGCACAANCATCAAACAGCATTGTCTTGAGAANTTGCTAAGATTCCTATNGTCCAGTTNTAGCTAGGGCTNNGGCACNAATGANATTCCAAAGCCAGCATTCCAGTCTTTTCCCTTTCTGTCATTCCTTGTGACATTGTGAGCACCCGGTTCTCCCAACAAATCGAATATGTNGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATATCTATAGAGAATATATA
  5   1   2       bld Ga15      in                       XL504l15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTaaaaagaaaaaaagtatttttgtcttttgtataaagctatactatagaaatatatactgtaaaacaaatagttgtacatttgtatatattattgtatataAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTTTTGCAAATAAAATTGATGTCACAGTTAGCAGTGGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL504l15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTATTGTATATAAGATTTGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATTTATATAGATGACTGAATACCATATAAAAGCATGTAAATAAATATATGTGTCAAGATTT
  3   1   2       bld Ga15      out                      XL505l15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGTTCTCCCAACAAATCGAATATGTTGCAAACTAAAAGCACATTTAGCTGAATCCCAAATGATATTCTGCATTCAATGCAGCCCATTTAAAAAGAAAAAAAGTATTTTTGTCTTTTGTATAAAGCTATACTATAGAAATATATACTGTAAAACAAATAGTTGTACATTTGTATATATTAGTTGTATATAAGATTNGTATATACTGTACATGCAACCAATTGAAATGTTTTTATTAAATTCCAATATNNATATAGANGANTGAATACCATATAAAAGCATGTAAATAAATATATGTTGTCAAGATTNTGCAAANAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)