Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8822556.5.5                    52 PI      85         74     1264                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8527081.5                       6 PI      91         89      781                (no blast hit)

 This cluster: approximate FL confidence score = 82%

 1012768155 Xl3.1-IMAGE:4683780-IMAGp.5 - 50 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4683780-IMAGp.5    GTGTCTGTTATGAACAGAGTCAGGGCTTTAAACTCCGTTGAGGCACAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTGTTTTAATGAATTGGCACTGTTTTTGTATCATTGTACCAAATAAATACTC
                                                  Xl3.1-CHK-1012686684          GTTATGAACAGAGTCAGGGCTTTAAACTCCGTTGAGGCACAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTGTTTTxAxxxAxTxGCACTGTTTTTGTATCATTGTACCAAATAAATACTCGCTTTA
                                                      consensus depths         2     2     3     6     3     7     4     7     8    13    18    23    20    28    26    31    29    33    29    33    32    35    33    35    34    35    35    37    36    38    36    38    36    38    36    38    36    38    36    38    36    39    36    39    37    40    37    40    37    40    37    39    37    41    38    41    38    41    37    41    37    41    37    41    37    41    39    41    39    41    39    42    39    42    39    42    38    42    38    42    40    42    39    42    39    41    37    41    39    41    37    41    39    40    39    40    39    39    38    38    37    37    34    38    34    38    36    38    33    39    36    39    33    39    35    40    27    39    25    39    19    36    20    37    19    35    20    33    19    32    17    30    14    28    16    28    14    26    13    25    13    23    11    21    10    21    10    19     9    18    10    17     8    15     9    16     9    15     9    15     9    13     9    11     9    11     8    11     9    12     9    12     9    12     9    12     9    12     9    12     6    12     6     8     6     8     6     7     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     5     6     4     6     3     6     2     5     2     5     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --A---------
                                               BLH ATG      69     263    
                                               BLH MIN      69     148    
                                               EST CLI      37      33    
  5   1   2       bld Te2N 5g                         IMAGE:7768412.5p CTGGTGTCTGTTATGAACAGAGTCAGGGCTTTAAACTCCGTTGAGGCACAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATNCAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAAGCTGNCAGGGAGCCNNGAGCANGTCATAGCAGCAGAG
  5   1   2       bld Brn1 5g                         IMAGE:7019255.5p    GTGTCTGTTATGAACAGAGTCAGGGCTTTAAACTCCGTTGAGGCACAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAAGAGCCTCCATGGTCCCTCTCGAATCCCCAGCCGCCCCTGCAGCTGGCGCTACCTACAAACGCTGACCCACCATTTGCCCTCTGAAGAAAGAACTCC
  5   1   2       chi Int2                            IMAGE:8527996.5p          GGCTTCTGAGTTTATTCCTATCAAAGCACTGGTCTAAGGGATCCCTTTAGATTTACTCTGGTGGCTCAGTGCCTTCGGGCTTTATATCTCATGCAAAGATTCTGAGTTCAATTCCTTCCAAAAAACTCAGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCATGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAAGCTGCAAGGGAAAGCCGAGCCAAGTCATAGCAGCAGAGGGGGAGA
  5   1   2       bld Int2                            IMAGE:8823248.5p            AACATGAGAATCTCACATAAAGTAAAAGATACTTAATTCGTCCCTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAGCAGAGCTGCAAGGAAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAGAAGCCTCCATGGTCCTCTCCGATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACATCGCCTCTGAGAAGGACTCCACATCGTCTTCCCTCTGCCATCGGACCTGGCTGACGGACTGGATGGAAAATAGATCTGAAGCTAGACGCAATGTATTTCAAGGGTGATCAGTTCCTGGAAG
  5   1   2       bld He1                             IMAGE:4408335.5p              TGAACAGAGTCAGGGCTTTAAACTCCGTTGAGGCACAGGGATTGCTNGTGGAAGTGAGTGAGACAGGCNTGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTGGCGATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGCGGCCAATATTACCAACGCAGACTCTGCCACCCGAATA
  5   1   2       bld Sp1       in                    IMAGE:4964661.5p              CACGCGTCCGCCCACGCGTCCGCTCCGTTGAGGCACAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCC
  5   1   2       bld Int2      in                    IMAGE:8820852.5p                     TCGTACTCTTTATATATTTTATCAGATTCAAATTCGTCCCGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACGATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTTTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAATGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGACGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAAGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGCTGCAAGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGAGATGACGCCTCCCGTGCCCTGAAAGAAGCTCATGGTCTCTCGATCCCCAGCCGCCCTGCAGCTGCGCTACTACAACGCTGACCACCATCGCCCTCTGAGAAAGAACTCACATGTCTCCTCTGCCCATCGACTGCTGAACGGACTGATGAAATAGATTCCGAGTTTAGACGCAAATGTATCAAGTGGAATCATTTCTTGGTCTGCTTTtctctctctctcGCGCGCGA
  5   1   2       bld Sp1                             IMAGE:4173433.5p                                                 CAGGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTGGNGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTTGATGTTGCAACAGATGACCTGGGTATCAAGGTGGGGCGAGTAGAGATTTAAGATGTGAAGCTGGCCATTCAGTTGCAGAGAGCCGATGCAGGCAGAGCAGCAGCCTGCAGGGTAGGCCCATCCAAGGTCATAGCAGCTGTAGGGGAGATGATCGCCTCCCTTGCGCTGAAT
  5   1   2       bld Sp1       in                    IMAGE:4963999.5p                                                  AGGGATTGTTACCGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAAAGATTGCCCATAACATGCAATCCACG
  5   1   2       bld FaBN                            IMAGE:8078880.5p                                                   GGGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTAGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAANGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAAGCTGCAAGGGAAGCCCGAGCCNAGGTCATAGCAGCAGAAGGGGAGATGAACGCCTCCCG
  5   1   2       bld Int2                            IMAGE:8822493.5p                                                   AGCCCCCTTGATACCTACCTAGTAATAAAATTTAAAATCGTCCCCCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTTCAGTTTGCAGAGAGCGATGGCGGCAGAAAGCAGAGCTGCAAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAACCTCCATGGTCCTCTCCGAATCCCCAGCGCCCTGCAGCTGCGCTACCTACAAACGCTGACACATCGCTCTGAGAGACTCCACCATCGTCTCCTCTGTCCATCGACCTGCTGAACGACTGATGAAAAAATAGAATCTGAGGTTTAAGAACGGTCT
  5   1   2       bld Kid                             IMAGE:7008449.5p                                                    GGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCATTTTTAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGGCAGAACAGAGGCTGCAAGGGAAGCTCGAGCTAGGTCTTGCAGCATAGGGGAAATGACGCCTCCCTGCCTGAAGAAGCTCCTGGGCTCTCGATCCTA
  5   1   2       bld Kid                             IMAGE:7012566.5p                                                    GGATTGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAAAGATTAAGATGTGAAGCTGCCCATTCATTGCAAAAACGATGGCGGCAAAGCAGAGGCTGCAGGGAAGCCCATCAAGGTTTAGCGGCGAGGGGAAATGAT
  5   1   2       chi Int2                            IMAGE:8526589.5p                                                      ATTGATAGTGGAAGTGAGTGAGACAGGCATCCCCTTAAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCTTGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCAACCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAAGGCTGCAAGGGAAGCCGAGCCAGGGTATATCCCCAGAAGCACATAAAGCAGTGTGCTACGATGCACCCAATGTCCTTGACACTCCTTTTACGGAATGTCATAAAACGGCAATGTATTTAAAATTCTTAACCTACAGTGGGAGAAAACTGGAAATCTGTACCTTTTGATCCCTGTCGATGAccccccccTCGATTTACCGGGACAATAAG
  5   1   2       bld FaBN                            IMAGE:8078603.5p                                                        TGATAGTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCTAAGGTCATAGCAGCAAAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATG
  5   1   2       bld Tbd7                                 XL102b14.5p                                                         GCAGGCAATTCGGCACGAGGCAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCG
  5   1   2       bld Emb4                   IMAGE:4683780-IMAGp.IMAGp                                                             GTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATC
  5   1   2       bld FaB       in                    IMAGE:8071109.5p                                                             GTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGTCATAGCAGCAGAAGGGGAGATGAACGCCTCCGTGCCCTGAAGAGCCTCATGGGTCTCTCGATCCCAGNCGCCTGCACTGGCTACTACAACG
  5   1   2       bld FaB                             IMAGE:8071323.5p                                                             GTGGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAAACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAAATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAATTGCAAAGAGCGATGGCGGCAAAATCAGAGGCTGCAAGGGAAGCCCAAGCCAAGGTCATAGCAGCAGAAGGGGAAATGAA
  5   1   2       bld Thy       in                    IMAGE:8549154.5p                                                             GTGGAAGTGAGTGAGACAGGCATGGCCGACAACATTGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAGCAGAGGCTGCAGGGAAGCCGAGCCAAGTCTAGCACAGAGGGGAGTGACGCCTCCGTGCCTGAAAAAGCTCATGGTCTCTCGATCCCAGCGCCTGAGCTGCCTACTACACGCTACACATGCTCGAAAAATCACATCTCTCTCGCACACTGTACGATGAAAATAATGAGTTAACGCATGATCAGTATCTGCGTC
  5   1   2       bld Emb4                            IMAGE:4683779.5p                                                               GGAAGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAAGCTGCAAGGGAAGCCCCGAGCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGNCCTCTGAGAAAGACCTCCACCATCGTCGTCCCCTCTGCCCCATCGACCTGCTGAAACG
  5   1   2       bld FaBN                            IMAGE:8077287.5p                                                               CGGATTCCCGGGATCAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGNCAGGGAAGCCCGAGCCAAAGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAGCCCTCATGGTTCTCTCGAATCCCAGCCGCCTGCAGCTGCGCTACTACAACAC
  5   1   2       bld Tbd7      in                         XL072n11.5p                                                                GTGAGTGAGNACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGNATTCCAGGNAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCTCCCCAAGAAATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAA
  5   1   2       bld EggS      in                    IMAGE:4785307.5p                                                                  AGTGAGTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTATGTAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAACGTCGACCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATACAATGAGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAA
  5   1   2       bld Ga18      in                      xlk122l05ex.5p                                                                   AAGTGAGTGAGANAGGCATGGNNNNCAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCNNTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGNAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGATGACTGGGGNATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGNTGCAGAGAGCGATGGCGGCAGAANNAGAGNNTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGNNGAACGCCTCCCGTGCCCTGAAAGAAGCNT
  5   1   2      seed FaBN      in                    IMAGE:8075152.5p                                                                       GTGAGACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAA
  5   1   2       bld Kid                    IMAGE:4031631-IMAGp.IMAGp                                                                            ACAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGG
  5   1   2       bld Lmb1                            IMAGE:8531969.5p                                                                            GACGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCACACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGNNTCTCTCGAATCCCAGCCCGCCTGCAGCTC
  5   1   2       bld Kid                             IMAGE:4031631.5p                                                                             CAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAACAGAGGCTGCCAAGGGAAGCCCCGACCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAAGAACCTCCATGGCCCTCTCCGAATCCCCAGCCCGCCTGAAGTTGGCCTACCTTACAAACGCTGACCACCATCGCCTCTGAGAAGGAACTCCACCATTCGTCTTCCCCTCTGCCCCATCGACCTGCTGAACGGACCTGATGAAAAAACAAAATTTCTGAAGTGTTTAAAACCGGCCAAAATGCAAATTTAAAGTGGAT
  5   1   2       bld FaB                             IMAGE:8073996.5p                                                                             CAGGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAAGCCGAGCCAAGTCATAGCAGCAGAGGGGAGATGACGCCTCCNGTGCCCTGAAGAGCCCTCATGTCTCTCGAAATCCCAGCGCCTGCACTGCCTACTACAACCTGACACATCGCTCTAGAGAC
  5   1   2       bld Kid                             IMAGE:4033274.5p                                                                              ACGCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTTAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGGCAGAAACAGAAGCTGCAAGGGGAAGCCCGAGCCAAGGTCATTACCAGCACGAGGGGGGAAATGAAACGCCTTCCCGTggccctgaaaagaaagccctccatggggcccctctcccgaaattcccccaggcccgccccctGGCAAGCCTGGCGCCCTATACCTTAAAAAAACCGCCTGGAAACCCACCACATTGGCCCCTCCCTGGaaaaaaaaaaaaaTTCTCCCACCCATTTCCGGTA
  5   1   2       chi FaBN                            IMAGE:8078074.5p                                                                                            CAACACCGAGCTCAGTCCAGGAGGGCATTCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCACAAATGACTGGGGTATCAAGGTGGAGCGATGGCGGCAAAAGCAAAGGCTGCAAGGGAAGCCCGAGCCAGGTCATACAGCAGAGGGGGAGATGAAGCCTCCGTGCCTGAAAGAGCCTCATGTCCTCTTAAATCCCGCCCCCTGCACTGCGCTACTAAAAGCGACACCATCGCTTGAGAAAATCACATCTTTCCTTGCCATGACTGTGAGGGTGATAAAAAGATTGAGTTAGACAGC
  5   1   2       bld FaBN                            IMAGE:8076522.5p                                                                                                CGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGC
  5   1   2       bld FaB                             IMAGE:8072948.5p                                                                                                                         CCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCCGCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCG
  5   1   2       bld Sp1                             IMAGE:4964274.5p                                                                                                                          CAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGNGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAA
  3   1   2       bld Int2      in                    IMAGE:8820852.3p                                                                                                                                                          CAGTTTTGCCACGAGAATGTGCCTTTCCGAGCGTCTGATTACAACTGTTTGGGATTCGTCTCATCTCACGATCTCACCTCCCATTCCATATGATGGCATAAAGATATAGATATGAACGAGCTATCATTCAGACTCGACGTATCTGCAAGTGAGCAAAGGGACCAGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTTTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAATGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGACGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATTGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGTCTTTCTCTTCTCGCCGAATCCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATTTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTAGGGGAAATAAGACCTTAGCAACTTATCCCCCCAAAAA
  5   1   2       bld Tad6                                Tad6-No75.5p                                                                                                                                                             CTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAG
  5   1   2       bld FaBN      in                    IMAGE:8075697.5p                                                                                                                                                                       GCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTANCAACGCTGACCACCATCGCCTCTGAGAAGAACNNTCACATCGTCTTCCCTCTGNCCATCGACCTGCTGAACGGACTGATGAAAAATAGATTCTGAGGTTTAAGAACGGCAAATGTATTCAAAGTG
  3   1   2       bld Thy       in                    IMAGE:8549154.3p                                                                                                                                                                                                                                          GCCATAAAAGATTATTAAAGGAATATGAACGAGCTATCATTTTCAGAACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCTGCAATGACAGCTTCATCAATGTGGATATGAGGACCATTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGTCCCATTAAAACTGTTTGGGGGAAAAATG
  5   1   2       bld Skin                            IMAGE:8642507.5p                                                                                                                                                                                                                                                                           TATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAATAGATTCTGAAGTTTAGAAACGGCAAATGTAATTCAAGTGATCATTTCTGGTCGGCTTCTCTCTCGCGAGTCGGTTTTCGAACATTTCGTGTCAAATATTCACTAGTTTGATTTGATCTGACATAAACGTTGGGGATAGAGTGTATTTGATTAAATGACTGACaaaaaaaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk122l05ex.3p                                                                                                                                                                                                                                                                                                                     GANNAANGGNNNGGTCTNNNTNGTNCTCCCTGCACTGACAGCTTCATCAATGNGGATATGAGGACCATTTCATTTGACNNNNNCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTNNCCTGGCAGTGGCAAATATTACCAACGCAGACTCTNCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGANCCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTNNNNNNNCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTTAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGNCCCATTAAAACTGTTTGGGGAAATAAGATNT
  3   1   2       bld FaBN      in                    IMAGE:8075697.3p                                                                                                                                                                                                                                                                                                                        GACCAGTCTGTTCTTCGTCTCCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTGACATCCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTGGGGAAANNAGAG
  3   1   2       bld EggS      in                    IMAGE:4785307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCCACCGTCAGTGTAGATGGCGTGGTTTACTACCGGTCCAATGATGTTACCCTGGCAGGGCAAATATTACCAACGCAGACTCTCCCACCCGTCTCCTGGCTCAGGACACCTTGAGAAATGTCTTGGGGACTAAGACCCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAGTCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCTCGATCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGAACCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTAGGGCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATATTTTGTGGAAAATCTATGAATATAATAAATAGTCTCTGGAAAA
  5   1   2       bld FaBN                            IMAGE:8078267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGTTGCACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCgggggggggTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTCTGTGTAACGCAGAANACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACNAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTT
  3   1   2       bld FaB       in                    IMAGE:8071109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCAGGTGAGGAGTGAGATTAGATGTGAGCTGCCATTCAGTGCAGAGAGCGATGCGGCAGAGCAGAGGTGCAAGGAAGCCCGAGCCAAGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCTGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTGTTTTTAATGAATGCACTGTTTGTATCATGACCAATAAATCTACGGTTT
  3   1   2       bld FaBN                            IMAGE:8075269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTGCAGAGAGCGATGCCGGCAGAAGCAGAGGCTGCAAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCATGAAAGAAGCCTCCATGGTCCTCTCCGAATCCCCAGCCGCCCTGCAGCTGCGCTACCTACAAACGCTGACCACCATCGCCTCTGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCATCGACCTGCTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTTTTTTAATGAATTGCACGGNGGNGANCANGACTATTAGAACCTAGTATTT
  3   1   2       bld FaBN      in                    IMAGE:8075152.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGGAGCCCGACCCAGGTCAAGCCGCCGAGGGGGAGAGAACCCTTCCGGGCCCTGAAGAAGCCTCCATGTCCTCTTCGAATCCCCAGCCGCCCTGCAGGTGCGCTACTTACAAACGCTGACCACCATCGCTTCTGAGAGAAACTCCACCATCGTCTTCCCTTTGCCCATCGACTTGTTGAACGGACTGATGAAAAAATAGATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTTCTCAGTCGGCAACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTGTTTTTAANGAATTGCACNGNGGNGNANCANGNCCNTATGACCTTTTTTTTCTAAAA
  3   1   2       bld Sp1       in                    IMAGE:4964661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCTGAGGTTTAAGAACGGCCAAATGTAATTCAAAGTGATCATTTCCTGGTCGGCTTTCTCTTCTCGCCGAGTCCGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATAAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTGTTTTTAATGAATTGCACTGTTTTTGTATCATTGTACCAAATAAATACTCGCTTTAACTGTGAAAAAAA
  3   1   2       bld Tbd7      in                         XL072n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGTTTTCCGAAACCATTTCTGTGTCCAAAAATTATTTCATCTAAGTTTTGATTTTGATTCTTTGACCCATTAAAACTGTTTGGGGAAATTAGATGTTTGTAAATCTATGAATATAATAAATAGACGCTGACAAATGTTATCCTATTCTTCTGTTACTCCCGGGGGGGGGTCACTAAGCAGTTTGGTAAGATGCTATTTAGGGGTGCACGTTGAGTAGCCCCAGTACTATGGAGAAACCACAGCTACGTGTGTGTAACGCAGAAAACAATGATAAAATATATAGATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTGTTTTTAATGAATTGCA
  3   1   2       add Sp1       in                    IMAGE:4963999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAGATGCTATTTAGGGGTGCACGTTGAGTACCCCCCCTCGTGGGGGGGAAACAAAAAAACGTGTGTGTACCGCAGAAAACAATGATAAAATAAATAAATTTTTGGGAGCAGATTACAATGTAAATAAGCTTTGCTATGAATCTGCAGGGAGTCTCACAGAAGACAAAGTTCTGCATTGCACTCTCAGTCGGCACCATGTGTGTGTTAGTTTCATTGAGGATCTGTTTTGTTTTTAATGAATTGCCCTGTTTTTGTATCATTGTACCAAATAAATACTCGCTTTACCTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)