Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl313i20.5                            8 END     4           7       50                hypothetical protein LOC495003 [Xenopus laevis]
     2   2.0    0Xl3.1-xl252o24.5                            8 END     3           5       37                hypothetical protein LOC100036716 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl252o24.5                            8 PI      93         36      414                hypothetical protein LOC100036716 [Xenopus tropicalis]
     4   0.0    0Xl3.1-xl305k16.3                            4 PI      91        960     1791                hypothetical protein LOC495003 [Xenopus laevis]
     5   0.0    0Xl3.1-xl305k16.5                            3 PI      90         33      792                hypothetical protein LOC495003 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012768191 Xl3.1-xl317j16.3 - 51 ESTs
                                                                       ........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl317j16.3                                                           CCAGGCAGGCCATCCCCAAATTGTGGTGACAAAGGTCCTGAGCCCCTGAGGACTCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGACAGTTGCACCCAAGAGGCCCTCGTCCAGTCGTGGGACAGTTTGTACCAGAGTGTGATGCAGAGGGCAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGATAAATTAGGGGAAGAGATTGCTGGAACAAGAACACAACCAGGCAGGACATCCCCAAATTGTGCAGACAAAGGTCCTGAGCCCCTGAGGACCCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGCCAATTGCACTCAAGAGGCCCTCATCCAATCGTGGGACAGTTTGTTCCAGAGTGTGATGTAGAGGGCAATTATGTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTAGGTGAAGAGGTTGCTGGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGCGGTGATACAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAAGCGGAGAACATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCTACCTCAATTTTTTTACTACTGTAAAGAAATTTTACTTTTACCTGTAA
                                                  Xl3.1-CHK-1012686646                                                                 AGGCCATCCCCAAATTGTGGTGACAAAGGTCCTGAGCCCCTGAGGACTCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGACAGTTGCACCCAAGAGGCCCTCGTCCAGTCGTGGGACAGTTTGTACCAGAGTGTGATGCAGAGGGCAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGATAAATTAGGGGAAGAGATTGCTGGAACAAGAACACAACCAGGCAGGACATCCCCAAATTGTGCAGACAAAGGTCCTGAGCCCCTGAGGACCCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGCCAATTGCACTCAAGAGGCCCTCATCCAATCGTGGGACAGTTTGTTCCAGAGTGTGATGTAGAGGGCAATTATGTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTAGGTGAAGAGGTTGCTGGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGCGGTGATACAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAAGCGGAGAACATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTxxxTxTACCTCAATTTTTTTACTACTGTAxxxxxAxxxxAxTTTTAC
                                                      consensus depths                                                                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     3     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     4     4     4     4     4     4     4     4     4     6     5     7     6     8     6     8     6     8     6     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    11    11    11    11    11    11    12    12    13    14    13    14    14    15    14    15    14    15    15    16    15    16    15    16    15    17    14    18    16    18    19    23    22    24    26    28    26    28    25    29    27    29    29    30    33    33    31    33    32    33    29    32    30    31    31    32    31    32    32    32    32    34    29    32    32    32    32    33    33    34    33    34    31    35    32    35    31    35    31    35    32    36    35    37    35    37    35    37    35    37    36    37    34    36    34    36    34    36    35    37    36    37    35    36    35    36    35    36    34    36    35    36    34    35    32    35    30    35    32    35    30    35    30    35    31    35    27    34    27    32    26    31    17    31    17    31    17    31    17    31    17    31    17    30    15    29    15    29    14    29    13    27    10    23     8    22     5    13     4    11     3    10     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A----T
  5   1   2       bld Ga12      in                         XL182l12.5p CTGGACTTGTTGGTGTGTGGACAAATTAGGTGAAGAGGTTGCTGAAACAAGAACACCACCAGGCAGGCCATCCCCAAATTGTGGTGACAAAGGTCCTGAGCCCCTGAGGACTCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGACAGTTGCACCCAAGAGGCCCTCGTCCAGTCGTGGGACAGTTTGTACCAGAGTGTGATGCAGAGGGCAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGATAAATTAGGGGAAGAGATTGCTGGAACAAGAACACAACCAGGCAGGACATCCCCAAATTGTGCAGACAAAGGTCCTGAGCCCCTGAGGACCCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGCCAATTGCACTCAAGAGGCCCTCATCCAATCGTGGGACAGTTTGTTCCAGAGTGTGATGTAGAGGGCAATTATGTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTAGGTGAAGAGGTTGCTGGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGCGGTGATACAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGG
  5   1   2       bld Emb4      in                    IMAGE:4960122.5p                                                           CCAGGCAGGCCATCCCCAAATTGTGGTGACAAAGGTCCTGAGCCCCTGAGGACTCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGACAGCTGCACCCAAGAGGCCCTCGTCCAGTCGTGGGACAGTTTGTACCAGAGTGTGATGCAGAGGGCAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGATAAATTAGGGGAAGAGATTGCTGGAACAAGAACACCACCAGGCAGGCCATCCCCAAATTGTGCAGACAAAGGTCCTGAGCCCCTGAGGACCCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGCCAATTGCACTCAAGAGGCCCTCATCCAATCGTGGGACAGTTTGTTCCAGAGTGTGATGTAGAGGGCAATTATGTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTANGTGAAGAGGTTGCTGGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGC
  5   1   2       bld Egg5      in                    IMAGE:3431438.5p                                                                                                                                                                                     CAGTTTGTACCAGAGTGTGATGCAGAGGGCAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGATAAATTAGGGGAAGAGATTGCTGGAACAAGAACACCACCAGGCAGGCCATCCCCAAATTGTGCAACAAAGTCCTGAGCCCCTGAGGACCCCTTGCTTAGAAAAGCGCCAGCAGTTGCTTGGCCAATTGCACTCAAGAGGCCCTCATCCAATCGTGGGACAGTTTGTTCCAGAGTGTGATGTAGAGGGCAATTATGTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTAGGTGAAAGAGTTTGCTGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGCGGTGATACAGCAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAAGCGGAGAACATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTTTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAA
  5   1   2       bld Em10      in                    IMAGE:7981691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCCGTTACAGTGTCATGGCAGCACTGGACATTGTTGGTGTGTGGACAAATTAGGTGAAGAGGTTGCTGGAACAAGAACTCCACCAGGCAGGCCATCCCCAAATTGCGGTGATACAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAAGCGGAGAACATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTC
  5   1   2       bld DMZ       in                         xl317j16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGGCCATCCCCAAATTGCGGTGATACAGAGCCCACTCAGAGACCTCAGACAGTATGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAAGCGGAGAACATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAG
  5   1   2       bld Neu7      in                         XL048l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTATGTGCCTCAGTGTGATCAATACGGTGACTTCAGCCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAA
  5   1   2       chi Tad2                            IMAGE:6932752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGCGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCACGCCGTACAATCAACCGGGCAAGCTTATAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCCGAGGACACTGTTTTGGACTGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACANAAAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAAGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAACCGGGAAGATTCCTGGTTAATGACAATCTTGGGCCCTTTCCCAGGTGTTTAACTCTTTGCCCCCCTTCCCCAAAAAATTTTTGTTTGGGCTGAATTCACAAACCCAAGAACCCTAGGtttttttttttaaaaaaaaGGCACCCCCC
  5   1   2       bld Tad2                            IMAGE:6876050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGCGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTATAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACTGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGGTTAATGACAACATTTGGCCCTTCCCAACGGGTTTAACCTTTGGACCCCCTTCTCCCAAAAAAGTTCTGTTTGGGGGCTCAAGCA
  5   1   2       bld Neu7      in                         XL043a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGGCTATTGCTGGTGTGTGGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGA
  5   1   2       bld DMZ       in                         xl230c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTG
  5   1   2       bld DMZ       in                         xl231c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATAAAGAAGGCAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACACCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCA
  5   1   2       bld Neu7      in                         XL041n20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGCATGTATACCCACAGTGGCACCTCCAACCATGCACCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACAGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGAC
  5   1   2       bld DMZ       in                         xl318m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGANGGATGGGGTAATATCTATTAAG
  5   1   0       add Neu7      in                         XL040j20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTNNGACCTCGGCAGGNAGGCAAGCAGTAGGTAGAAAAGCATACGTAACACTTGGATGGCAGAAATAGTAGCGTACACAAGGCATGGACATTGGGAAAAAAGTCTTACAATACATAACCGTGGTAGGTACCAATGCGTGGGGAACTAAAGCTGCAACGAGTTTCCTGGAGTATTATTATGTGTATATATATGAATCATTCCAGTGATGGCACTTGCAAATGAACCCTAAAGTGACTTGTGGAATTTAAACCGTAGGCAATTTAGAGAAGGCTGCAGTTACTGGCTGCTTGATTTAGTCATTCCGCTAGCTTCAAAAGGCATAATAATTACTTCTACAAAGGGGCATAATAAGCAGTTGGTTGTGTTTTTAGCAAAAGCTCTTTTTCCCTGTCACACAAAGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTG
  5   1   2       chi Tad2      in                    IMAGE:6873570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATTGGATACTTACCTCTCAACGGCACAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAATCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAACAACCTAGAATGCATTTTTGTCACATAGAAACTGGGGCGACGGGTCTTACAGAAGTAACCTTGAATTAATCCTTTCCACCGGTTGGTTGCATATGCAAAATCACTTTCTACCCACCCAGAACTGGAAAGGAGGGAATGGGGGTAAATTATTCTATTTAAAAAGGGAACCCTTGGGGCACCATTGGGAAAAAAGAAATACCCTTTCCCCGGGAGCCCAAAGAATACTCCTTCTTTTACTTGGGGA
  5   1   2       bld Ga15      in                       XL498e09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGGCTCCATAAGGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTANAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTANAANAATACCTTCCTGAGCAGANATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCA
  5   1   2       bld Ov1                             IMAGE:8332433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATAAAGCCAGGACACTGCTGTCCCTTCATGGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCC
  3   1   2       bld Tad2      in                    IMAGE:6873570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTCCAAGGTTTCTTATTGGGGGGTGGGAATTCGATTAATGAACTGCCCCGAGGAAAAATGGTTTTACCGGGACCGGATGTTGCAGGCCCGTACAATCCAACCGGGGCAAGGTTTGAAACCCGGGCGCAGAAGGCAGAAATTATTTTTTAACCCAGGGGTTGATGAGCACAGAGGGGTTAGCCCATTGACTACTTTCGGAGGGACACTGTTTGGGACCGACAGCGGCCTAGATAAGATGAGGAGTTCTCGCTTGGATGGTACAGAGAAGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCAATGTGGATGCAGTGAGAGGGAATCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATCATAAAAGCCAACAAATATAGTTGTAA
  3   1   2      seed DMZ       in                         xl317j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTTCTATTGTGGTTGGGATCGATTATGACTGCCACGAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCAATTT
  3   1   2       bld DMZ       in                         xl318m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAAATGGTTTACTGGACGGATGTTGCAGGCCGTACAATCAACCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTAC
  5  -1   2       bld Sp1                             IMAGE:5505825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCNGTACATTCACCCGGGCAAGCTTAGAACCAGGCGCAGAAGCAGAAATATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACTTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGtttttttttacctcaattttttACTACGTATTAAAGATT
  3   1   2       bld DMZ       out                        xl313i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGNCAAGCTTAGAACCAGGCGCAGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCNNGCAAAAAGCCAACAAATATAGTTAGAAAAG
  3   1   2       bld DMZ       in                         xl230c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCGCAGNAGCAGAAATTNTTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTACCTCAATT
  3   1   2       bld DMZ       out                        xl266c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAGCAGAAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTACCTCAATTTTTACT
  5   1   2       bld DMZ       in                         xl246h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAA
  3   1   2       bld Ga18                             rxlk112d16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAANCANAANTTATNNTNACACAGGGTTGANNNGCACAGAGGGTTTANCCATTGNCTANNTCGGAGGACACTNTTTTGGACCGACAGCGGCCTAGATAAGANTGAGAGTTCTCGCTTNNATNGTACAGAGANGAAGATTCTGTTTGACACACAGCTTGTCANNCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTANNCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACNNNNNTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAANCCAACAAATATAGTTTGTAAAGTTTTTTNNCCTCAATTTTTNNCTAC
  3   1   2       bld DMZ       in                         xl246h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTNTTTTNACCTCAAT
  5   1   2       bld Tad2                            IMAGE:6934786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGAAATTATTATTAACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCTTTTTGTCAGATGGAACTGGCCGACGGTTCATACAGAGCAACCTGAATTCTCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACGGGAgggggggtggggTAATATCTATTAAGAACGTCGTTGCGCCCTTTGAAAAACAATCCCTCCCCGAGCATATATCTCATCTCTATGGAAAAACCGCCCGTGTATCCATACTGCCCcgggggggaagaaagtaaaaagtgagaagggggaaaataatttttgaggggaaTATCCTCCCCCTTTGCTGCCATTGGAGGGGGATGGGAAAAGACTCCACCACCtttttctttttttggaaaacctggaaaaaaaaattaccttttttttttttCCTGGCAAAAAGAGCCCT
  3   1   2       bld DMZ                                 rxl245m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACAGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCT
  3   1   2       bld DMZ       out                        xl265n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACNTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCAATTTT
  3   1   2       bld DMZ       in                         xl231c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTACCTCAATTT
  3   1   2       bld DMZ                                 rxl223d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGATGAGCACAGAGGGTTTAGCCATTGACTACCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTNCCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCNCATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTNTNTGGAATATCAGCCGTGTATCCATACTGCCCNTCAGGGAGAAAGTAAAAAGNGAAAAGTGGAAAAGAATTTNGATGGAAGATCTTCCCCTTGCTGCAGNTAAAGNGATGGCAAAGAATCAGCACAAAT
  3   1   2       bld DMZ  5g3  out                        xl252o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATTGACTATCTTCGGAGGACACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGATGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGAAAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATT
  3   1   2       bld Ga12                                 XL212n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGTTTTGGACCGACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTNTANGGAATANCAGCCGNGTATCCATNCTGCCNTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCNCCTTGCNGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTNCTTGGAATACNGCAAAGAAAAAGCTTTATTTTCNNGCAAAAAGCCA
  3   1   2       bld Ga12      out                        XL212c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACCGACAGCGGCCTAGATAAGATNGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTG
  3   1   2       bld Ga12      in                         XL182l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCGACAGCGNCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTAAAGAAAT
  3   1   2       bld Ga15                               XL417c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGCGGCCTAGATAAGATTGAGAGTTCTCGCTTGGATGGTACAGAGAGGAAGATTCTGTTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCA
  3   1   2       bld Egg5      in                    IMAGE:3431438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGTTCTCGCTTGGATGGACAAAGAGGAAGATTCTGTTTGACACACAGCTTGTCAAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGGATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATGCTGCCCTTCAGGGAAA
  3   1   2       bld Neu7      in                         XL048l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGACACACAGCTTGTCAACCCCCGAGCCATCACTGTGGATGCAGTGAGAGGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGnAAATTTTACCT
  3   1   2       bld Neu7      in                         XL040j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTTCCCTGTCACACAAAGGAACCTGTATTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGAAATTTTACC
  3   1   2       bld Neu7      in                         XL041n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCAT
  3   1   2       bld Emb4      in                    IMAGE:4960122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAGAGAGCCTCCAAAGATTGAATCGTCCTTTGTAGATGGATCAAACAGGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGAAATTTTACCTGTAA
  3   1   2       bld Emb4      out                   IMAGE:4959201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCCAAAGATTGAATCGTCCTTTGTAGATGATCAAAACAGGAGGATTCTGGTTAATGACAACATTGNCTTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGAAATTTTACCTGTAAAA
  3   1   2       bld Ga15      in                       XL498e09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAGATGGATCAANCAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGNCCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTANCCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATNTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCC
  5   1   2       bld Ga18                              xlk143e05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTAGATGGATCAAACAGGAGGATTCTGGTTAATGACAACATTGGCCTTCCCAACGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGtttttttttacctcaatttttttactactgtatttttaaagaaattttacctgtaaaaaaaaaa
  3   1   2       bld He1       out                   IMAGE:4408047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGACAACATTGGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGAAATTTTACCTGTA
  3   1   2       bld Ga12                                 XL183l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCTTCCCAACGGTTTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAA
  3   1   2       bld Sp1       out                   IMAGE:4962906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAACCTTTGACCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTACCTCAATTTTTTTACTACTGTATTTTTAAAGAAATTTTACCTGTAA
  3   1   2       bld Em10      in                    IMAGE:7981691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGAAAGCTAGAATGCATTTTGTCAGATGGAACTGGCCGACGGGTCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACATAGTTTGTAAAAGTTTTTTTTTTTTACT
  5   1   2       bld Ooc1                              xlnoc003g13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTAAAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGAATGGGAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGttttttttacctcaatttttttactactgtatttttaaagaaattttacctgtaaaaaaaaaaaaaaaaaaCCTAAGCATGTTGGCCTGCTTGGCACCAAAAAGACGTGCCACGTGTACAGAGAT
  3   1   2       bld Neu7      in                         XL043a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATACAGAGTAACCTGAATTATCCTTTCAGTGTTGTTGCATATGCAAATCACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCTATTAAGAAGGACACTGGGCACATTGTAGAAGAATACCTTCCTGAGCAGAGATCTCATCTCTATGGAATAACAGCCGTGTATCCATACTGCCCTTCAGGGAGAAAGTGAAAAGTGGAAAAGAATTTTGATGGAAGATCTTCCCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAAGCTTTATTTTCATGCAAAAAGCCAACAAATATAGTTTGTAAAGTTTTTTTTTACCTCAATTTTTTCTACTACTGTATTTTTAAAGAAATTTTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)