Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 82%

 1012768269 Xl3.1-xlk77a20ex.3 - 57 ESTs
                                                                       .......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk77a20ex.3                                                TCGGGGAAGTGCCGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACGACGACGAGGAGGTAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAAGTGTAAAAAATACTTTATCTGTTTG
                                                  Xl3.1-CHK-1012686422                                                      TxGxxxCGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACGACGACGAGGAGGTAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCxTTxxxTCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAAGTGTAAAAAATACTTTATCTGTTTGTAAAAA
                                                      consensus depths                                                     4    15     5    16     9    23    10    26    12    27    17    29    14    29    15    30    20    31    18    31    20    32    29    32    30    33    30    34    30    34    30    34    31    36    33    36    35    37    37    39    41    42    38    42    40    43    43    44    43    44    45    47    46    47    46    47    46    47    46    48    45    48    45    48    43    49    46    49    48    49    47    49    48    49    49    50    48    51    46    50    45    49    47    51    49    51    46    51    49    51    47    51    48    51    48    51    47    51    45    51    45    50    45    50    45    51    45    51    45    51    41    50    43    48    40    48    40    48    38    44    34    44    36    41    35    40    34    38    31    35    32    34    31    34    31    33    30    32    30    32    30    32    30    32    27    30    14    30    14    30    11    23    11    17     5    11     4     7     4     6
                                                                   VAR                                                            AGTCCGTGTTCTCCAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACG
                                                                   VAR                                                                                                                        TAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCATCGCTCCC
                                                                   SNP                                                                                                            -C--------G-
                                                                   SNP                                                                                                                                    ----A-A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                            -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------G--
                                               BLH ATG       4     269                                                
                                               BLH MPR       1      83                                                
  5   1   2       bld DMZ       in                         xl242o17.5p AATTGTGGGTGAATCTCGCTGTCTCATCCCCGCTGCTGCTGCTGAGCAAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCATGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGCTGCCGTGCCC
  5   1   2       bld Ga15                               XL424n13ex.5p            GTGAATCTCGCTGTCTCATCCCGGCTGCTGCTGCTGAGCAAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGaggaagaggatgaagacgacgacgaggaagaagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTANCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCA
  5   1   2       bld Tbd5                            IMAGE:3581394.5p                             CCCGGGGCTGCTGAGCCAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGGGCAGtggatgaggaggaagaggatgaagacgacgacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTG
  5   1   2       bld Ga14                                Ga14-p3f5.5p                                      CTGCTGCTGAGCAAANGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtnagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTT
  5   1   2       bld Te2                             IMAGE:7394056.5p                                      GCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGGGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCACGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACAGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATGTCAGGTATTGGGAATCCCGCTGTCTCTACGGTGCTACACGATTCTCAAACTGGATCTGTCCTATAA
  3   1   2       chi Ga15      in                       XL417l14ex.3p                                      TCCGGAGCAAAATGGGCCANGTTCTTTCGGGGAAGTGCAGTCCGTGTTCTTCCAGGGCTGTGGATGAGGGAGGAAGAGGATGAAGACGACGACGAGGAAGAAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATNGGGGCTCAAACTGTTTTTTGCTATGTATAANAAAAGNAAAA
  5   1   2       bld Lmb1                            IMAGE:8533488.5p                                      TGCTGCTGCTGAGCAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCagagctgtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCGCTGTCTTCTACCGTGCTACCGGATATCTCCAACTGGATCTGTCCTATAAGGCTTTCGACCCTCTATCAGTGAAGCTGAGCGATGGCGCGACTCGCATAT
  5   1   2       bld Te2N                            IMAGE:7205797.5p                                        TGCTGCTGAGCAAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATgaggaggaagaggatgaagacgacgacgaggaagaagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATNATCTCCAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGGAGCCTGAGGCGATTGGCTGCGGACTCTGCAAATATCCCAGAAACTCTGAGAAAGACGGTGAAAATGAAACGAAATTCCGAAGTAACCCTTAAATCTAGCCCCTGTTCACCGCTCCCCCTTGGTT
  5   1   2       bld FaBN      in                    IMAGE:8075536.5p                                        CTGCTGCTGAGCAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATgaggaggaagaggatgaagacgacgacgaggaagaagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAAATCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTNATTAGGCTTTNCGNNACCCTCTATCCAGTGAAA
  5   1   2       bld Ga15      in                       XL402m07ex.5p                                          CTGAGCAAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGAggaagaggatgaagacgacgacgaggaggtagaagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCANGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTC
  5   1   2       bld DMZ       in                         xl238p05.5p                                           GTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCACGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATT
  5   1   2       bld DMZ       in                         xl282o17.5p                                           GTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCACGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGT
  5   1   2       bld DMZ       in                         xl330h13.5p                                           GTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCACGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACAC
  5   1   2       chi Ga15      in                       XL417l14ex.5p                                                AGCAAATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGGGCTGTGGATGAGGAGGAagaggatgaagacgacgacgaggaagaagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCANAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTCAAACTGTTTTTTGCTATTGTATTAATGAAAAGTGTAAAAAAATACTTTATCTGTTTGA
  3   1   2       bld Ga18      in                       xlk77a20ex.3p                                                GNCAAATGNNNNCGTNCTNNGGGNAAGTGCAGTCCnnnnTCnnnnnnnCTGTGGATGAGGAGGAANAGGATGAAGNCGNCGNCGAGGAGGTAGAAGAAGACAGAGAGATCATTNNGGAGCTGGAGAGGAAGAGGNAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGNCTCCCCTGCTCNAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAATGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCAAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGANCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATNAGANG
  5   1   2       bld Ga18      in                       xlk77a20ex.5p                                                     AAATGGNCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacAGAGAGATCATTGCNNNNNNAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACANTGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGANCCCACGGTCCTGCTGTGNCAGTGCAACTGTCATGTGGCAGAAGANCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAATGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTNAGGACTAGCAAGTACAGAGAGGAGGNNNCNTNNNNCCTGCTGGAACAGNCCAATATAGTGGATGGNCTTCCTNCTGCAGTNNTGTCCCATTGTCAGGTATTGGGAATCCCCNCTGTCTTCTACNAGTNCTACAC
  5   1   2       bld Ga18      in                      xlk164i10ex.5p                                                              CGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCagagctgtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCNNNNNGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGACTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGNCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGNTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGNCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTNNTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACAC
  5   1   2       bld Ga12                                 XL209d11.5p                                                                 GAGGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGtggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCA
  5   1   2       bld Ga18      in                      xlk164j02ex.5p                                                                  CTTCGGGGAAGTNCAGTCCGTGTTCTCCAGAGCTGtggatgaggaggaagaggatgaagacgacgacgaggaagaagaagaagacagagagaTCATTGCGNNNNGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTNNCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGNCCCCTGCTGGAACAGNCCAATATAGTGGATGGGCTTCCTGCTGCAGTNNTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCT
  5   1   2       bld Neu7      in                         XL017n20.5p                                                                   GGGGAAGTGCAGTCCGTGTTCTCCAGGGNCTGtggatgaggaggaagaggatgaagacgacgacgaggaagaagaagaagacagagagaccattgcggagctggagaggaagagggagGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGG
  5   1   2       bld Ga15      in                       XL432g03ex.5p                                                                     GGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAATGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCAAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCANTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCA
  5   1   2       bld Te2N                            IMAGE:7766417.5p                                                                      GGAAGTGCAGTCCGTGTTCTCCAGGGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacagagagaTCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGNAAGCCTGAGCCGATTGGNCTGCGACTCTGCAAATA
  5   1   2       bld Te2N                            IMAGE:7204317.5p                                                                       TCCAGGGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGTACAGCCATTAATCACGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTTAAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTC
  5   1   2       bld Emb3                            IMAGE:3400062.5p                                                                         AGTGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTTCTATATACTGAGCTCCTGCAGTTGGGAAGTGGCTGGATCTGTCACACTGGGGAACGAGAGATGCAGAGACTGCAACGTCAGAGAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAAACCACACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAACTTAAGACCAGCTTGTTCCATGGTGCCAGAAAGGTTTTGGCTCA
  3   1   2       chi Int2                            IMAGE:8823089.3p                                                                         CCCTTAGATGCACCATAATATATTTAAATTTTTAAGGTATTCATTTATCACCTTTAGAACTAGCTTCATACCCAGAGGTGCCCAAATACTGTTCCTTTACAGTGCATTTAATACAAATATTGATTTCAGAGCATCACAAATGATGTCATGTACATGCACTCTGCTAGTTACTGGAACTTGCTAGTAACCAGTGAGTAATTAGTTAACTAGTAATGGGTTTTCTCCAGGTTTTTGTGGCCACATGTTTCCCGTGCTGCCTGGCTCCTCTACACCCTCCCTCACATTACACACTAATCACAATTAAATACAATGTCTTTATAGTTTATCCGGTTTAGGGGCTTCTTCCAAACTGACTGCATCTTGTTTCTCTCAGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCTACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTATCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTGTCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTCACCCTCTTGGTATGAAAAGCATGTTTAAAAACGGAATATGGT
  5   1   2       bld Ga15      in                       XL414m20ex.5p                                                                           TGCAGTCCGTGTTCTCCAGAGCTGTggatgaggaggaagaggatgaagacgacgacgaggaggtagaagaagacAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGACTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCNAACTGGATTCTGTCACTATT
  3  -1   2       chi Bla2                            IMAGE:7297329.3p                                                                                        CAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACGACGACGAGGAGGTAGAAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGGCACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCCCATTGGAAAAGAACAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGGTTCTCGATATAAAACCCCAGAGTCACGTACAGTCTCCCTGTTCCTTTTTGAANGCCTGAGGCTAGCGAGTCAGAGAGGAGTGCGTGCCCCTGCTGGACAGCCATATAGTGATGGCTCCTGCGCGTGCTGCCTTGCAGATTGGATCCTGCGCTCACATGCTCCGATTCCACTGATCGTCCTATAGCTCACCTCTTCGTGAGCGACGTGTGCGACCATCAATAAAGATAATACTATCCCCTTGATC
  3   1   2      seed Ga15      in                       XL432g03ex.3p                                                                                                    TGAGGAGGAAGGAGGATGAAGACGACGACGAGGGAGGTAGAAGAAGACAGAGAGATCATTGCNGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAATGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCAAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAAGAGAAG
  3   1   2       chi Ga18      in                      xlk164j02ex.3p                                                                                                         GATGAGNANNANGAGNATGANGACGNCGNCNNGAANAAGAAGANACAGAGAGATCATTNNGGAGCTGGANNNNNAGGNAGGTGCGTGTGACATGGAACCCTGANCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGNCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGNCCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGANCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTANNGTANTAA
  3   1   2       bld Ga18      in                      xlk164i10ex.3p                                                                                                                                CGNCGNCNNGNGTNNNNANACAGAGAGATCATTNCNNAGCTGNAGNGGAAGAGGNANGTGCGTGTGACATGGAACCCTGANCTCACAGCAGCCATTGAAAGCTCTCCTGNCAAAAGNCTCCCCTGCTCCAGTGTCATCTTGTCTNTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGANCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGNCCTGTCATCNCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATNAGA
  5   1   2       bld Ga12      in                         XL210d11.5p                                                                                                                                                AAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGNCCTGCTGTGCCAGTGCAACTGTCATGTANCAGAAGACCAGCTGTTCCAG
  3   1   2       bld Ga15                               XL447n03ex.3p                                                                                                                                                                        GGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCNTGAGCTCACAGCAGCCATNGAAAGCTNTCCTGGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATANTGAGCTNTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAATGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCAAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATG
  3   1   2       bld Ga15      in                       XL402m07ex.3p                                                                                                                                                                                        CGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCCTGGCAAAAGGCTTCCCCCTGCTCCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTAT
  3   1   2       bld FaBN      in                    IMAGE:8075536.3p                                                                                                                                                                                                     ACATGAACCCTGAGCTCACAGCAGCCATGAAAGCTCTCCTGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATTTTTTGCTACTGATAAGAGAAGCTAACAACTATTCTT
  3   1   2       bld Ga15      in                       XL414m20ex.3p                                                                                                                                                                                                                                       CCTGGCAAAAGACTCCCCTGCTTCCAGTGTCATCTTGTCTGTCGGGGACAATGCAACAGGGTTTTGTATCTTCCTATATANTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTAT
  3   1   2       bld DMZ       in                         xl282o17.3p                                                                                                                                                                                                                                         CCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTAT
  3   1   2       bld DMZ       in                         xl242o17.3p                                                                                                                                                                                                                                                                CAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCATGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGCTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAGCTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATTGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTGCTATG
  5   1   2       bld Ga15      in                       XL464e01ex.5p                                                                                                                                                                                                                                                                         CTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGACACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCNCTCCCTTTGTATCGGGCTCCAAACTATGTTTTTTGCTATTGTATTAATGA
  3   1   2       bld Ga15      in                       XL464e01ex.3p                                                                                                                                                                                                                                                                         CTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTAT
  3   1   2       bld DMZ       in                         xl238p05.3p                                                                                                                                                                                                                                                                                     TGACAATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTAT
  5   1   2       bld Gas8                   IMAGE:3516088-IMAGp.IMAGp                                                                                                                                                                                                                                                                                          ATGCAACAGGGTTTGTATCTTCCTATATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGCATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTCAAACTGTTTTTTGCTATTGTCTTAATGAAAAGTGTAAA
  5   1   2       bld Gas8                            IMAGE:3516088.5p                                                                                                                                                                                                                                                                                           TGCAACAGGGTTTGTATCTTCCTATATACTGTTCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTTTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATACTGTCACTATTAAGGCTTGCCGACCCCTTCTATCCAGTGTAAGCCTGAGCCGATTGGCTGCGGACTTTGCAGATATCCAAGATACTCTGAGACAGACGGTGAGAATGAACGAGATTCAGAGTTACCTTTAC
  3   1   2       bld Ga12      in                         XL210d11.3p                                                                                                                                                                                                                                                                                                                      ACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTNTGTATCGGGGCTCA
  3   1   2       bld DMZ       in                         xl330h13.3p                                                                                                                                                                                                                                                                                                                               TGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCTGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGCTCAAACTATGT
  3   1   2       bld Neu7      in                         XL017n20.3p                                                                                                                                                                                                                                                                                                                                                      TGTCACACTGTTGNAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTCAAACTGTTTTTTGC
  5   1   2       bld Ga15      in                       XL487i22ex.5p                                                                                                                                                                                                                                                                                                                                                            CACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAAGTGTAAAAAATACTTTATCTGTTTGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL487i22ex.3p                                                                                                                                                                                                                                                                                                                                                            CACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAA
  5   1   2       bld Egg1                               PBX0091B12.5p                                                                                                                                                                                                                                                                                                                                                                                                           CACGAGGGGTTTTTAGTGGGAAAATGTTCTTATTACAGGTGTCTGGGGCAGGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTC
  5   1   2       bld Egg1      in                    IMAGE:4677962.5p                                                                                                                                                                                                                                                                                                                                                                                                                 GCTACTGATTGACTCTTGCACGTGCATCTAAGTGTATCCAGCAATGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCTAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTAC
  3   1   2       bld Egg1      in                    IMAGE:4677962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTAAGTGTATCCAGCAATGTCCTGCTGTGCCAGTGCAACTGTCATGTAGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTGTATCGGGGCTCAAACTGTTTTTTGCTATTGTATTAATGAAAAGTGTAAAAAATACTTTATCTGTTTGTAAAA
  5   1   2       bld Ga15      in                       XL417p22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTCAAACTGTTTTTTGCTATTGTATTAATGAAAAGTGTAAAAAATACTTTATCTGTTTGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL417p22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCCATCGCTCCCTTTGTATGCGGGGCTCAAACTGTTTTTTGCTATTGTATTAANAAAAGT
  3   1   2       bld Eye1                            IMAGE:4743771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGGTGCGAAAAGGTATTTGGCTCATTGAAAAAGACCAGCTTGAAAGTACCGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTTTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCACATTGTCAGGTATTGGGAATCCCTGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTCCCCCTAGCCCTGTCCATCGCTCCCTTTGTATCGGGGCTCAAACTGTTTTTTGCTATTGTATTAATGAAAAGTGTAACCACATACTTTATCTGTTTGTAAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL427m05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAAGTGTAAAAAATACTTTATCTGTTTGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL427m05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCGGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTAT
  3   1   2       bld Ga18      in                      xlk106d06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCCCCTGCTGGAACAGCCCAATATAGTGGATGGGCTTCCTGCTGCAGTGCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGANCCGATTGGCTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCNCTCCCTTTGTATCGGGCTCAAACTATGTTTTTNGCTATTGTANNAATNAGAA
  5   1   2       bld Ga18      in                      xlk106d06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCCCCTGCTGGAACNNNNAATATAGTGGATGGGCTTCCTGCTGCAGNCTGTCCCATTGTCAGGTATTGGGAATCCCCGCTGTCTTCTACCAGTGCTACACGGATATCTCCAAACTGGATTCTGTCACTATTAAGGCTTTCCGACCCCTCCTATCCAGTGGAAGCCTGAGCCGATTGGNTGCGGACTCTGCAAATATCCAAGAAACTCTGAGAAAGACGGTGAAATTGAACGAGATTCAGAGTAACCTTTACATCTAGCCCTGTCATCGCTCCCTTTGTATCGGGCTCAAACTATGTTTTTTGCTATTGTATTAATGAGAAGTGTAAAAAATACTTTATCTGTTTGTNANANAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)