Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5085413.5                      53 PI      78        119      660                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:7204111.5.5                    38 PI      79        119      660                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7204147.5                       7 PI      79        119      669                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012768323 Xl3.1-IMAGE:7766816.5 - 60 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7766816.5                                    GTGCTGCTCCTGTTTCTGGGAGGGCTGGGAGGGGTTGGGACACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAATAAAAGCATGTTGCCTGCTCTAGGCCTTCTCTC
                                                  Xl3.1-CHK-1012686327                                          CTCCTGTTTCTGGGAGGGxTxxxxxxxxTxxxGxxxCCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAATAAAAGCATGTTGCCTGCTCTAGGCCT
                                                      consensus depths                                         2     2     2     3     2     5     5    10     8    16    10    21    25    25    14    26    26    28    32    37    34    41    39    42    39    42    37    43    39    43    40    44    40    45    41    45    41    45    41    45    41    46    41    45    42    47    42    48    43    49    43    50    44    50    45    50    44    50    45    50    48    51    48    51    48    52    47    52    47    52    46    52    46    52    48    52    47    52    48    52    49    52    48    52    49    52    41    52    48    52    47    53    47    53    48    53    47    53    46    52    45    51    44    52    45    52    46    52    45    51    44    52    42    52    36    51    36    51    35    51    33    49    34    48    31    47    31    46    30    42    28    40    26    39    24    38    21    36    12    34    11    32    15    31     8    26     8    23     7    22     8    21     8    20     8    20     8    19     8    18     6    17     7    16     7    11     7    11     5    10     6    10     6    10     6    10     6    10     5     9     5     9     4     9     4     8     2     6     2     6     2     5
                                                                   VAR                                                                                    GAGATCTGACGGTTGCTGCTGCTG
                                                                   VAR                                                                                                                        CTCGCATATTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTGGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGGCCCCCCGATGCCTTTT
                                                                   SNP                                                                                                            -------T----
                                                                   SNP                                                                                                                                    ---A-A------
                                                                   SNP                                                                                                                                                --------C---
                                                                   SNP                                                                                                                                                                                                            C-----------
                                                                   SNP                                                                                                                                                                                                                        T--G--------
                                                                   SNP                                                                                                                                                                                                                                                            ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                            ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                            ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -TA---------
                                               BLH ATG     118    1243                                    
                                               BLH MIN     118     142                                    
                                               BLH MPR     118     142                                    
                                               BLH OVR     118      42                                    
                                               CDS MIN     118      17                                    
                                               EST CLI      34      17                                    
                                               ORF LNG     118       1                                    
  5   1   2       bld Te1  5g                         IMAGE:6930134.5p GGGATATAGCCGTTTCCGTGCAGGAGTGGGCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCTGACACTGCCGGGCTTCCTGGAGATCTGACGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGTTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTTATAGAAACCCTCTGCACTTGGATTTCCACAAAACGTGGGAAGCTGGCTTTTCCAGACTATACTTCACAGAGAATCTACCCGCCATTGGGGTCCCCAAAACGCCGAATGTTCCGAACAAGC
  5   1   2       bld DMZ  5g                              xl330p03.5p                                    GTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCC
  5   1   2       bld Ga15 5g                            XL464c10ex.5p                                                GCTCCTGTTTTCTGGGAGGGGTTCGGACACCGCCGGGCTTCCTGGAGATCTGACAGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCANGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGANACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATTGGGGTGG
  5   1   2       chi Tad1                            IMAGE:6936671.5p                                                 GGGTCCTGTTTCTGGGAGGGGTTCGGATACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTACAACGATGGCTAAAGGAACTAAGGGACCACGCCGACAATTAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACCTTGAGAGCTGTACCCCCGGATGAAGCCCGCGCATTTTGCaaaaaaaaaTGGATTGTCCTTTATAGAAACCTCTGCCCCTGGATTCAACAAACGTGGAAATCTTGCTTTCCAGACTAGTACTCCCAAAAGATCTTTCTCCATTTTGGTCCCATAACGCACGATGTCCGAACAGAACTGGGGAAATGAACTTGTCCCCCAAATTAACCAACGGTGGTTCCCCCATCTCCCTGGCCCGCCACCCACTGGAAAATTAACCCCAATGTTGC
  5   1   2       bld Te1  5g                         IMAGE:6929762.5p                                                    GGGGTTTTCTGGGAGGGGTTCGGACACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAATGGATTGTCTTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGGCATTGGTGTCCCCAGACGCAGAATGTTCGGAACAGACCNTGAAGAATTGACATGTCCCCCAAAGTAACCAACGTGGGTGCCCCCATCCCACCGTTGccccccccAC
  5   1   2       bld Egg3 5g                         IMAGE:3378258.5p                                                                  CCGGGCTTCCTGGAGATCTGACGGTtgctgctgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAAGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCNGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATGTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACANACGTGGAAGCTGCTGTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTGCGACAGACGTGAGAATGACGATGTCCCAAGTAACCATGTGGTTCCCATCCATGTGCCCCCGACCACTGAA
  5   1   2       chi Te1                             IMAGE:6929386.5p                                                                      GGGGGACACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACCTTAACCTATGAGAATGGAAAACCGATGGCTTAAAGGAACCTAAGGGGACCTCCGCCAGACTATTAAAAATAGTTTTATCCAGGCTTGGGTGGGGGCAACACTAAAAGATGTGTTCTCTGCGGGGCCCCTTTTAATAAAGCTTTGTTCCCCACCGGGGATTTATATACCCCCGTTTGCCTTTTTTGTTTGGaaaaaaaaaatgggtgtttgggcccttttttttttGTAAAACCCTTTTGGCCCCTTGGGGTTTTCCCCACTTAAAACGGGGTGAAAGCCCGGCCTTTTTCCCCCGAATTATTTCTCCCCCCCGTGGAGTTACCTTACCCGCGCATTGTTGTGTGCCCCCAAAN
  5   1   2       bld Te1  5g                         IMAGE:6928830.5p                                                                      GGGGGACACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTTCCGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGTAGAATGACATGGTCCCCAAGTAACAACGTGGGtcccccatccacgtgcccccccaccccTTGAAAATTAAACCCAGGATGCCAATGCCTGGTCAGAAACTTCT
  5   1   2       bld Te1  5g                         IMAGE:6930296.5p                                                                      GGGGGACACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCCGACTATACTCACAGAGATCCTCCGCATTGTGTCCCAGACGCAGATGTCAGACAGACCTGTAGAATGACATGTCCCCCAGTAACAACGTGGTTCCCCATCCACGTTGCCCCCCAACCACTGTAAAATAAACCAAAGATGCCATTGCTGTCCAGA
  5   1   2       bld Emb4 5g                         IMAGE:4679791.5p                                                                       TCGGATACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACA
  5   1   2       bld Tad1 5g                         IMAGE:6937139.5p                                                                          GGGACCGCCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTATCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATNGTCCCCAAGTAACAAACGTGGTCCCCCATCCACGTGGCCCCCCCACCACCTGGAAAAATAAACCCAAAAGATGGCAATGCCTC
  5   1   2       bld Te2  5g                         IMAGE:7210070.5p                                                                                GGAGATCTGACGGTTGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGCCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTATACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAGTAACAATGTGGTCCCCATCCTGTGCCCCCACCACTGAAATAAACAAAGATGCATGCTGTCGACATCTATGGTGCTGCTGCGCTTGCCGGCTCGTATATCCTCTCTGCTGGACTCTGGATCTTTGTTNGTAATAAAAAATTTGGTTAGGACTGTAGACTTATACATCACGATTCTGCTATCTGATCT
  5   1   2       bld Ga15 5g3  in                       XL450c22ex.5p                                                                                 CCGGGCTTCCTGGAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAANCATCCAGGTGGATGGCAAGACCATTAAAGCTCANATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCANAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACTCTTTAttttttttttttttA
  5   1   2       bld Te2  5g                         IMAGE:7393312.5p                                                                                   GGAGATCTGACGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCCAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAATAACCAAGATGCATGCTGTCAGACATCTATGGCTGCTGCTGCGCTGTGCGGCTCTGTATATCCTCGTCTGCCTGNACTCTGGATCTTTTNGTTGTATA
  5   1   2       bld Ga18 5x3                           xlk73k23ex.5p                                                                                   CGGNNTTCCNNAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTNNAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGNNTGCTNNCT
  5   1   2       bld Te2  5g                         IMAGE:7210207.5p                                                                                    GAGATCTGACGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCACCACTGAAATAAACAAAGATGCATGCTGTCGACATCTATGGTGCTGCTGCCTGTGCGGCTCTGTATATCCCTCTCTGCTGGATCTGGNATCTTTGTTGTATAAAAAATATATTTGTTGAGGACGGTTTGACTTATACATCACTGATTCTGCTA
  5   1   2       bld Thy  5g3  in                    IMAGE:8550450.5p                                                                                      GGAGATCTGACGGTTGCTGCTGCTGCTTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCNNCAGTACATGTGGTCCCATCCATGTGCCCCCCACACTGAAATAAACAAAGATGCATGCTGTCAGACATCTAATGCTGCTGCTGCGCGTGCCGGCTCTGTATATCCTCGTCTGCCTGACTCTGGGATCTTTTGTTGTANANNAAAAAAATTTGTTGAGGACGGTAGACTTATTTCATCATCGATTCTGCTATCTAGATCGATAGATAT
  5   1   2       bld Te1                             IMAGE:6929189.5p                                                                                           GGGGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAAGCCCGTGCATTTTGCCaaaaaaaaaatggaattgtcccttttaagaaaaacccccctcccccTGGGATTTCAAACCAAACCTTGGGAAAAACCTGTCTTTTTTCCCCGAACATTAATTACctcccccccggaagaatttctttaccccgcccctttttggtggtggttccccccccaaaaacaccccccaaaaaatttgtctcccccacaacaaaaaaa
  5   1   2      seed DMZ  5x3  ?                          xl300j11.5p                                                                                           GACGGTtgctgctgctgctgctTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATAT
  5   1   2       bld Egg3 5x3                        IMAGE:6322625.5p                                                                                             GATTCCCGGGCGCTGCTGCTTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTcttttttgttttgttatatatatnatatatttttttgttttGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTANATTCTTATGATTTTCTGGATTAAAGATATGATCTCTTTTCTCACCCTCTTTCACTGAGC
  5   1   2       bld Te2N 5x3                        IMAGE:7766816.5p                                                                                             GAGATCTGACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACttttttttttggatttttttttttGTGTTAAAATAAATATT
  5   1   2       bld Te2N 5x3                        IMAGE:7203324.5p                                                                                                     ACGATTGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACtttttttttttggaattttttttttgtggttataatatatatttttggttttaagtggtttaagaacttttaattttactatttCCATCTGGGATTT
  5   1   2       bld Te1  5x3                        IMAGE:6929913.5p                                                                                                        GGGGCTGCTTCAGTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCCAGTAACAACGTGGTCCCCATCCCCGTGCCCCCCACCACTGTAAAATTAACCCAAGATGCAATGCTGTCAGAACATCTAATGGCTGCC
  5   1   2       bld Ga15 5g3  in                       XL477p05ex.5p                                                                                                         CTGCTGCTTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCCGGGCTCTGTATATTCCCCTCGTCCTGC
  5   1   2       bld FaB  5x3                        IMAGE:8074290.5p                                                                                                         CTGCTGCTTCTGTTCCTCGCATATTCCGAAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCNTCGNNTCTGCCTGNNACTCTGGAANTCTTTTTGTTTTGTAatatatattatatatatTTT
  5   1   2       bld FaB  5g                         IMAGE:8072124.5p                                                                                                                    GTTCTCCGCAGATTCTGAACGTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAACCCCAAGATGCATGCTGTCAGACATCTATGGCTGCTGCTGTGCTCTGCCGGCTCTGTATATCCCACGTCCTGCCTGACTCTTTAtttttttttttGATC
  5   1   2       bld Brn1 5x3                        IMAGE:6951123.5p                                                                                                                               GTCCGGAATTCTCGGGATGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCttttttgttttgttaatatatatatatatattttttgttttgaatgaacctgttttatgaacttttaatttACCAATTCCATCCGGGGATTTTTACTTGGTCTAAAATTCTTATGAATTTCCGGGATAAAAGAAATGATCCTCTTTTCTTCCCCCC
  5   1   2       chi Ga18                                xlk2i19ex.5p                                                                                                                                  ACTGATTCCTGTGCTGTCAGACAAGTGTGATTTATGTCTTTTTAATGGTAAACGGTCTGGTAATTACCCCATTATATGATTTGCTGTTATGTAGATATAATAGCCCCTTCCATCCGTTCTTCCTATAAGTAAATCACACCTTTTTCCCTCTGTCGTATATGAGCTACAGATCCCAGAAAATGCTAGGAGTCATACTTCATTGCTGCAGAAGAGCAATGGACTAATCTCCAGCACCCTAAACCCTTGTACTCTTCCAACAGGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCTNCCACCACTGAAAATAAACCAAAGATGCAATGNTGTCAGAACATCTAATGGCTGCTNNCT
  5   1   2       bld FaB  5g3  in                    IMAGE:8071253.5p                                                                                                                                     GAAGACAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCTCGTCCTGCCCTGGACTCTGGATTCTTTNNTTGTTTGTATAT
  5   1   2       bld Brn1 5x3                        IMAGE:7019309.5p                                                                                                                                        GTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACTCTTTAtttttttttttttgaatctttttggaattttttttttGTGTGTTAATATAAATATATTTTTGGTTTTGAGTGTTTAAAGAACTTTTAATTTTACTATTTCCATCTGGGATTTTTTACTTGGTCTTAAA
  5   1   2       bld FaBN 5g                         IMAGE:8077616.5p                                                                                                                                         GTCAGAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAATAAACCAAGATGCAATGCTGTCAGACATCTAATGGCTGCTGCTGTGCTCTGCGGCCTCTGTATATCCCACGTCCTGCCTGACTCTTAtttttttttttgatcttttggattttttttGTGGTAAAAAAATATTTT
  5   1   2       bld DMZ  5x3  ?                          xl319e06.5p                                                                                                                                          CAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATA
  5   1   2       bld DMZ  5x3  ?                          xl312a14.5p                                                                                                                                          CAGAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTG
  5   1   2       bld Tbd3 5x3               IMAGE:3548264-IMAGp.IMAGp                                                                                                                                            GAAGTGCCGCGAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGCACTCTTGGAATTCTTTTTTGTTTTGTTAatatatatatatatatTTTTGTTTTGAGTGTACGTGTTTTATGAACTTTAAT
  5   1   2       bld Egg1 5g                         IMAGE:4784118.5p                                                                                                                                              GAAGTGCCGCGACGATGGGTACCAGGGACGACGAGTACGATTATCTCATCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTTTTTCTGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCC
  5   1   2       bld Emb4 5x3                        IMAGE:5514019.5p                                                                                                                                              AGTGCCGCGACCATTTGAACCAGGGACGACGAGTACGATTATCTCTTCAAAGTCGTTTTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTATCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGActtttttntttggaannttttttttgggtaataatatatttttgtttGAGTGTT
  5   1   2       bld Emb4 5x3                        IMAGE:5514018.5p                                                                                                                                              AGTGCCGCGACCATGTGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTATCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGNACttttttttggaaatttttttttGTGTAATATAATATTTTGTTTGAGTGTAA
  5   1   2       bld Neu7 5g3  in                         XL019n06.5p                                                                                                                                                   GCGACGATGGGTACCAGGGNACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCT
  5   1   2       bld Kid  5x3                        IMAGE:4033023.5p                                                                                                                                                      GAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCCAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCCTGCCCTGTGCCGGGGCTCTGTATATTCCCCCTCGTCCTGCCCTGGGACTCTTGGGaatatcttttttggttttggttaaatataatataatatataattttttggtttttGAAGTGGAACGTTGTTTTATGGAACTTTTAAATTTTTAACTATTTCCCAATCTGGGGATGTTTTTACCCT
  5   1   2       bld Brn1 5x3                        IMAGE:6955030.5p                                                                                                                                                      GAGGATGGGTACCAGGGACGACGAGTACGATTATCTCTTCAAAGTGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAatatatatatatatatTTTTGGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTTCCATCTGGGATTTTTACTTGTCTTAAAATTCTTATGAATTTTCCGTATTAAAAGATATG
  5   1   2       bld Tbd3                            IMAGE:3548264.5p                                                                                                                                                            GGGTACCAAGGACGACGAGGGCGATTATCTCTTAAAAGTGGTTATGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAAAAGCATTCAGGTGGACGGTAAGACCATTAAAGCTCATATCTGGGACACAGCCGGACAGGAGCGATACAAATCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGATAATGTGGAACGATGGCTGAAGGATCTAAGGGACCACGCTTACAATAGAATAGTA
  5  -1   2       bld Te2N                            IMAGE:7767968.5p                                                                                                                                                                        CGACGAGTACGATTATCTCTTCAAGTGGGTTCTGATTGGAGACTCCGGCGTTGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAatatatatatatatataAAAAA
  5   1   2       bld Egg3                            IMAGE:6867185.5p                                                                                                                                                                                               GATTCCCGGGCTGATCGGAGATTCGGTGTGGGGAAGAGAATCTCTTGTCCAGATTCACACGCAATGAGTTCAACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACttttttttttggaattttttttttGTGTTAATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGGATTAAAGAAATGATCTGTTaaaaaaaaaaaaaaaaaaaG
  5  -1   2       bld Te2N                            IMAGE:7768740.5p                                                                                                                                                                                                                  TTGTTCTCATCGACGAGCGAGTGTCAGCCGATCGTCTTCAGGTCGATGGATCGCGTGAGATATTTGTCAGTCCCGCAGAGTACTGAGAGCAGACACTCGGGTGATCGTACAGAGCTCCAGTGACGCAGACCATAAGCTCAATCTGGACCAGCCGACAGAGCGATACAGACCATCACTCAGCGTATACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAatatatatatatatatatTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTC
  3   1   2       bld Ga15 5g3  in                       XL477p05ex.3p                                                                                                                                                                                                                         TNGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAANGAGTTTAACCTGGAGAGCAAGAGCACCATCGGGGGTGGAATTCGCTACAAGAAGCATCCAGGTGGACGGCAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATATTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTA
  5   1   2       bld Gas5      in                    IMAGE:3750777.5p                                                                                                                                                                                                                                                                          ACCTGGAGAGCAAGAGCACCATCGGGGTGGAATTCGCCATCAGAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGAACAACGTGGTCCCCATTCACGTGCCCCCCA
  5   1   2       bld DMZ       in                         xl307j20.5p                                                                                                                                                                                                                                                                                                      ATTCGCTACAAGAAGCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTNATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACttttttttttggaattttttttttGNGT
  5   1   2       bld DMZ       in                         xl306j20.5p                                                                                                                                                                                                                                                                                                      ATTCGCTACAAGAANCATCCAGGTGGATGGCAAGACCATTAAAGCTCAGATCTGGGACACGGCCGGACAGGAGAGATACCGAGCCATCACTTCAGCGTATTACCGAGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAGCACTTAACCTATGAGAATGTAGAACGATGGCTAAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACttttttttttggaattttttttttG
  3   1   2       bld Thy  5g3  in                    IMAGE:8550450.3p                                                                                                                                                                                                                                                                                                                  GGTCGTGAAGTATCTCGTCAGCAGGTACTGACAGCCATCGTGATCGTCAGAGTCAGTGCGCAGCATAAGTCATTGGACCACGACAGAGGTACGAGCATACTCAGGTATACGGGAGCGTGGGGCCTGTGGGTAGACATGCCAACATTAACTATGGAATGTGAACGATGGTGAAGAACTAAGGGCCACGCAGACATAAAATAGTTATCATGTTGGTGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATATATTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGGCCCCCCGATGCCTTTTTTTTTTCTCTTGCTCCCCCTGCCCCTCTCTCCGCCTAATCATACAAGACAATCATTCCATGATCATAAGCCTAGCCTTCCCAGTAACTCACCCATGAATCATAAATCATGTCTAGAAAGGGCGAAAGACGCCAAATAA
  5  -1   2       bld Te2N                            IMAGE:7765917.5p                                                                                                                                                                                                                                                                                                                                 CGCAAAGACCATTAAAGCTCAGATCTGGGACACAGCCGGACAGGAGCGATACAGAGCCATCACTTCAGCGTATTACCGGGGAGCGGTGGGGGCCCTGCTGGTGTATGACATTGCCAAACACTTAACCTATGAGAATGTGGAACGATGGCTGAAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAatatatatatatatatatTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTC
  3   1   2       bld Thy                             IMAGE:8546433.3p                                                                                                                                                                                                                                                                                                                                               AGAGCTCAGTGACGCAGACATAAGTCAGATTTGACCAGCGGACAGAGCATCAGAGCATCACTCAGCTATACGGGGAGCGTGGGGGCCTGCTGTGTATGCATGCCAAACACTAACCTATGAGAATGTGAACGATGGCTGAGGAACTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGATCTGCGGCACTTGAGAGCTGTACCCACAGATGAAGCCCGTGCATTTGCAGAAAAGAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATATATTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGGCCCCCCGATGCCTTTTTTTTTTTTCTCTTGCTCCCCCTGCCCCTCTCTCCGCCTCTCTTTACAAGACAATGATTCCATGATCCTAAGCCTAGCCTTCCCAGTAACTCACCCATGAATCATGGAATCATGTCTTGAATGGCAGAAGAGCGC
  5  -1   2       bld Te2                             IMAGE:7390480.5p                                                                                                                                                                                                                                                                                                                                                                                                  GACCGCGACAGAGGTACGACATCATCAGGTATCGAGAGCGTGGGCCTGCTGTTAGACATGCCAGCACTACCTATGGATGTAGACGATGCTAAGGAACTAGGGACCACGCAGACATAAAATAGTATCATGTGGTGGGCAACAAAAGTGATCTGCGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGTGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACttttttttttggaattttttttttGTGTTAATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAATAAAAGCATGTTGCCTGCTCTAGGCCTTCTCTCCTC
  3   1   2       add FaB  5g3  in                    IMAGE:8071253.3p                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCTCACTCGGTATACCGGGGCGTGGGCCTGCTGTGAGACATGCAAACATTAACTAGAGATGTGAAGATGGTGAAGAATTAGGACCAGCAGACAATAAATAGTATCAGTTGGTGGCAACAAGAGGATCTGGGCACTGAGAGCTTACCCACAGAGAAGCCCGTGCATTGCAGAAAAGAATGGATTTCCTTTATAGAAACCTCTGCACTGGATTCAACAAACGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCCGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCATGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTGTGCCGGGCTCTGTATATTCCCCTCGTCCTGCCCTGGACTCTTGGAATTCTTTTTTGTTTTGTTAATATATATATATATATATTTTTGTTTTGAGTGTACGTGTTTATGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGATATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGGCCCCCCGATGCCTTTTTTTTTTTTCTCTTGCTCCCCATGCCCCTAGAGCGCGTAACACTCAAGACAATCATTCCATGACTCTATAGAGGGCTTCCCAGTAACTCAGCTTGAGTCAAGAACGATTCTTGCAGGCGTAAACTCGTTT
  3   1   2       add DMZ       in                         xl306j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAATAAAATAGTTATCATGTTGGNGGGCAACAAAAGTGATNTGNGGCACTTGAGAGCTGTACCCACGGATGAAGCCCGNGCATTTGCAGAAAAAAATGGATTGTCCTTTATAGAAACCTCTGCNCTGGNTTCAACAAACGTGGNAGNTGCTTTCCNGNCTATACTCACAGAGATNTACCGCATTGNGTCCCNGACGCAGANGTCAGACAGACGNGAGAANGACANGTCCCCAAGNAACAACGNGGTCCCCATCCACGNGCCCCCCNCCNCTGAAAATAAACCAAAGNTGCAATGCTGTCAGAACATTTAANGGNTGNTGCCTGNGNTNTGCCGGCCTCTGNATATTCCCCNCGTCCTGCCCTGGNCTTTTTTTTTTGGAATTTTTTTTTTGTGTTAATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCNTGCTCCCCCTGCCCCTCTGTCTGCNTCTNTCTAAAGACAATGATTCCATGATTCNAAGCTTAGCCCTNCCAATAAGNCNCACATCTGT
  3   1   2       bld DMZ       in                         xl307j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGCCCGNGCANTTGCAGAAAAAAATGGNTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAANGGGGAAGNNGNTTTCCNGANTANACTCACAGAGNTTTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAANGACATGTCCCCAAGNAACAANGNGGTCCCCATCCACGNGCCCCCCACCNCTGAAAATAAACCAAAGATGCAANGCNGTCAGAACATCTAANGGNNGNNGCCTGTGCTNTGCCGGCCTNTGTATATTCCCCACGTCCTGCCCTGGNCTTTTTTTTTTGGAATTTTTTTTTTGTGTTAATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCNTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGGAATAAAG
  3   1   2       bld Gas5      in                    IMAGE:3750777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGACTATTACTCACAGAGGTCTACCGCATTGTGTCCCAAACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAACGTGGTCCCCATCCCCGTGCCCCCCACCGCTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACTCTTTATTTTTTTTTTTTTTGAATCTTTTTGGAATTTTTTTTTGTGTGTTAATATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCACCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCGGTCTGCCTCTTTCTAAAGACAATGATTCCATGGTGNTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAATAAAAGCATGTTGCCTGCTCTAGGCCTTCTCTCCTCAAA
  5   1   2       bld Kid                             IMAGE:7009595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGTCCCCAGTAACAACGTGGTCCCCATCCACGTGCCTCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGTGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGACTCTTTAttttttttttttttgaatctttttggaattttttttttttgtgtgttaatatatatatatTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCACCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAATAAAAGCATGTTGCCTGCTCTAGGCCTTCTCTCCTCN
  3   1   2       bld Ga15 5g3  in                       XL450c22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTNAAGGGGGGNGCCCNGGGTTTNCCNGNCCNNGGAAANTNCCCCCNGCCCGNCCCGGGNNTTTTnnTTTTTTTTTTTTTGAATnTTTTTGGAAATTTTTTTTTTTTGTGTGTTAATATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCACCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTCTTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAGCTTAGCCCTCCCAATAAGTCACACATCTGTATAAAATATGAAAAAAAGCA
  3   1   2       bld Neu7 5g3  in                         XL019n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGGCTGCTGCCTGTGCTCTGCCGGCCTNTGTANATTCCCCACGTCCTGCCCTGGACTTTTTTTTTTGGAATTTTTTTTTTGTGTTAATATATATATTTTTGTTTTGAGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCATCCTCTTTCACTGAGCCTGATTGGCTCCCGCCGCCTTTTC
  3   1   2       add Neu7                                 XL018o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANTTTTTTTTTTGTGTGTTAATATATATATATTTTTGTNTTGAGTGNTTAAGAACTTTNATTTNACTATTCCATCTGGATTTTTACNTGTCTTAAATTCNTATGATTTTTCTGTATTAAAGAAATGATCTGTTTCTCNCCCTCTTTCACTGAGCCGGANTGGCTCCCGCCGCCTTTTCNTTCTCTTGCTCCCCCTGCCCCTCTGTCTGCCTCTTTCTAAAGACAATGATTCCATGATTCTAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)