Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7205686.5                      17 END     11         33       64                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012768656 Xl3.1-XL164a08.3 - 33 ESTs
                                                                       .......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL164a08.3                                                                                        TGCTAAGTCCGTCCTTACAGATTGGGTGAGTGGTAAAATCAGTTACTTCACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687737                                                                                              GTCCGTCCTTACAGATTGGGTGAGTGGTAAAATCAGTTACTTCACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAAAA
                                                      consensus depths                                                                                             3     4     3     5     3     5     3     5     4     7     4     7     4     7     4     7     4     8     6     9     6     9     7     9     7    10     8    12    10    14    12    14    13    14    13    14    15    16    16    17    16    17    17    18    20    21    20    21    20    22    22    24    23    25    22    25    23    25    22    25    22    24    21    24    22    24    22    24    22    24    21    24    24    26    25    27    27    27    27    27    27    27    30    30    29    30    30    30    31    31    30    31    31    31    30    30    30    30    30    30    29    30    29    30    29    29    29    29    28    29    29    29    29    29    28    29    27    28    26    27    25    26    25    26    25    26    25    26    24    25    24    25    23    24    23    24    22    24    23    24    20    23    15    21    11    17     8    10     7     7     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------A--T
  3   1   2       bld Tail      out                   IMAGE:8541827.3p GCATGAAGCATTGAGCGTCACAAGACGATCATACATTCCATGGCATCGATAACTGGATCTGGCATGCTGCTAACGCAGTAGCTGAAAGGTGGCACACGATCATGAGAAGCTGTAGTCGTCTACAGATGGTGAGTGGTTAATCAGTACTCACACATCTCGAGACCCACACATGCTACACACATCAGTGCGAGATGTTACAGAAATGGGAAGGCATTTGATTTGAGGCTGGAGATGGACACCATGAGTCTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCCGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTGAAATGTGCATTAACAGAAATAAAATACCCA
  5   1   2       bld Neu7      in                         XL008h14.5p                                                    GCTGAAAAGGGTGGCACACCGGNATCATGAGAAGGCTGCTAAGTCCGTCCTTACAGATTGGGTGAGTGGTAAAATCAGTTACTTCACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaaCTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGG
  5   1   2       bld Tbd2                   IMAGE:3200191-IMAGp.IMAGp                                                                                     GGCTGCTAAGTCCGTCCTTACAGATTGGGTGAGTGGTAAAATCAGTTACTTCACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCcgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaacTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTT
  5   1   2       bld Tbd2      in                    IMAGE:3200191.5p                                                                                      GCTGCTAAGTCCGTCCTTACAGATTGGGTGAGTGGTAAAATCAGTTACTTCACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCcgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaacTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAA
  3   1   2       bld Thy                             IMAGE:8548695.3p                                                                                                    GTGTACGCGTAGGAAAGTGCCCGATCGAGAGTGTATCTCTACGATGTGAGGTAATCATACTCACACTCTCCGAGCCACACATGCTCACACTCATGCGAGATGTACAGAATGGGAGGCATTGATTTGAGCNTGGAGATGACACCATGAGTCTTGTCAAAGGTCAGTCAGCCCCGCAGGGCATTGTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTGAAATGTGCATTACAGGAAAATCCTA
  5   1   2       bld Ga12                                 XL153k05.5p                                                                                                                              CACGAGGACTTACACATCCTCCGGAGACCCACACAATGCCTACACACATCAGTGCGGAGATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaaCTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAA
  5   1   2       bld Neu7      in                         XL003k20.5p                                                                                                                                        CACATCCTNCGGAGACCCACACAATGCCTACACACATCAGGTGCGGAGATTGTTACATGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCANGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCNAAGAAGAGGNGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAANAGCANAGTCCAGCCA
  3   1   2       bld Ga15      out                      XL407m24ex.3p                                                                                                                                                                                       GATTGTTACAGAAATGGGGAAGGCATTTGATTTTGAGGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACNTGAAATG
  5   1   2       bld EggS      in                    IMAGE:4785412.5p                                                                                                                                                                                              TACAGAAATGGGGAAGGCATTTGATTTTGAGGCCTTGGAGATGGACAACCATGAGTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCTATGGAACAGGACATTGATACAGAGTTTGGTCCCATTATTGTGGAAATCACAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaaCTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCC
  3   1   2       bld Ga12 5g3  out                        XL164a08.3p                                                                                                                                                                                                                               TTGGAGATGGACAACCATGAGTTCTTTGTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATC
  5   1   2       bld Neu7      in                         XL017p22.5p                                                                                                                                                                                                                                                   GGNCTGCAGGNAATTCGGCACGAGGCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGGCACCGTTTACATTTAATTGGNTTGGTGAGTGCCCTGGGATGCACAG
  5   1   2       bld Tbd7      in                         XL105d09.5p                                                                                                                                                                                                                                                    GAGTCTTTGTNAAGGTTCGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGTGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTC
  3   1   2       bld Ga15                               XL408m24ex.3p                                                                                                                                                                                                                                                          GTCAAAGGTTCAGTCAGCCCCGCAGGGCATTGTTATGGAGGTCTGNGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCANCTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGNNTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGANCNAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGNTATTGNCCNTNTGCAGCAAGGNCAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACNAAATTGCAACAANANNGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTGTGCAGCCCCACACTCCAGACANTCGTCTTTATCATACCATNTGAACTGTGCNGTGTAGATGATGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCC
  3   1   2       bld Ga18 5g3  out                      xlk59b04ex.3p                                                                                                                                                                                                                                                            TNAAANNTNNAGTNNNNCCCNNAGGGNATTNTTATGNNGNNNNGNGGNCTCANAGCTGGTGTCGANGANGNGGTGGAGGATNNTGNACTGGATGAGTCAAGTGGTGAGGATGAAAANCCAACTGATTCCATGGAACAGGACATTGANACAGAGTTTGNTCCCATGACTGTGGAANTCAAANNCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGNCCNNNNNGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGNNNNTNAAATNNG
  3   1   2       bld Neu7      in                         XL008h14.3p                                                                                                                                                                                                                                                                                                       TGGACTCACAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTAAATGTGCATTTACAGGNAATAAAATC
  5   1   2       bld Ov1                             IMAGE:8331759.5p                                                                                                                                                                                                                                                                                                         GGACTCCAGCTGGTGTCGAAGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCcgcaagcaagaagaggaaaaagatgcaaaagcgagcaaacaaaattgcaacaaaacTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGATAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTA
  3   1   2      seed Ov1  5g3  out                   IMAGE:8329596.3p                                                                                                                                                                                                                                                                                                                            AGAAGAGGTGGAGGATGTTGAACTGGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7                                 XL002f03.3p                                                                                                                                                                                                                                                                                                                                                    GGATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTAAATGTGCATTTACAGGAATAAAATCCAT
  3   1   2       bld Tbd7      in                         XL105d09.3p                                                                                                                                                                                                                                                                                                                                                      ATGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTAAATGTGCATTTACAGGAATAAAATCC
  3   1   2       bld Neu7      out                        XL043c14.3p                                                                                                                                                                                                                                                                                                                                                       TGAGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATT
  3   1   2       bld Neu7      in                         XL017p22.3p                                                                                                                                                                                                                                                                                                                                                         AGTCAAGTGGTGAGGATGAAAAACCAACTGATTCCATGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTAAATGGCATTTACAGGAA
  3   1   2       bld Ga18 5g3  out                      xlk58p23ex.3p                                                                                                                                                                                                                                                                                                                                                                                   ACTGANTNCNATGNANNAGGACATTGATACAGANTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCNANCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGNNCNNNNNGCCGCAAGCAAGAAGAGGAANAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCCGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAANGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGNCCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAG
  3   1   2       bld Neu7 5g3  out                        XL038o02.3p                                                                                                                                                                                                                                                                                                                                                                                             TGGAACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTNACAGGTAATAAAAT
  3   1   2       bld Tbd7                                 XL099i23.3p                                                                                                                                                                                                                                                                                                                                                                                                 ACAGGACATTGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCCGATTCNTTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTNTTAAAGCCCATCAGCGNCCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTT
  3   1   2       bld EggS      in                    IMAGE:4785412.3p                                                                                                                                                                                                                                                                                                                                                                                                               CAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCAAAAAAGCAAAGTCCAGCCAGAAACAGAACAAGTGGTTCCCAAAGCCCCAAATCTAAAGGAGATTCAAGCTATTGACCCTCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTAAGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTGACATTAAATTGTTATGTGAGTGCCCTGGGATGCACAGT
  3   1   2       bld Tbd2 5g3  out                   IMAGE:3201371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCA
  3   1   2       bld Tbd2      in                    IMAGE:3200191.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAGCAAGGACAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAA
  3   1   2       bld Emb4 5g3  out                   IMAGE:4203314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCCCTGCTCGCCGCAAGCAAGAAGAGGAAAAAGATGCAAAAGCGAGCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCAATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAAA
  5   1   2       bld Tbd1                                 AW764356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAACAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGNGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAAA
  3   1   2       bld Neu7      in                         XL003k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAAATTGCAACAAAACTGTCCGATTCATTAACGCTAGCAATGAATTTTTCANTGAGCGATGANTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCNCACTCCAGACACTCGTCTTTATCATACCATCTGANCTGTGCCGTGTAGATGCTGATGTCCTACTCATGCNTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTGACATTTAATTGNTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTAAAATGTGCATTTACAGGAATAAAA
  3   1   2       bld Ga12 5g3  out                        XL141j01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAATTGCAACAAAACTGTCAGATTCATTAACGCTAGCAATGAATTTTTCANTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGTCCCTGGGATGCACAGTTAGGCACTTGGAAATGTGC
  3   1   2       bld Tbd1                                 AW764719.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATTAACGCTAGCAATGAATTTTTCACTGAGCGATGACTGAAGCAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCAAA
  5   1   2       bld Ov1                             IMAGE:8331547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGAGGCGAACTTTTAAAGCCCATCAGCGACCATTATGGTGCATCATCTCTGCAGCCCCACACTCCAGACACTCGTCTTTATCATACCATCTGAACTGTGCCGTGTAGATGCTGATGTCCTACTCATGCTTGTGTGCAATATAAAGGGTTTCCACCCTGTAGAGTTTTGTCCCCCAGCCAAAGACAATTTCCATCAGCTCGCTCTTTTTTCCACCATAGGTTTATATGACCTTTTACATTTAGCACCGTTTACATTTAATTGTTATGTGAGTGCCCTGGGATGCACAGTTAGGCACTTGAAATGTGCATTTACAGGAATAAAATCCATAGTGTTACTGCaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)