Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012768814 Xl3.1-IMAGE:6877243.5 - 62 ESTs
                                                                       -80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6877243.5                                                                                 CATGCTTCGCTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAAAAAAAACCCCCCCCCCCC
                                                  Xl3.1-CHK-1012686251                                                                                       TCGCTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAAAAAAAAxxxxxx
                                                      consensus depths                                                                                      3     4     8    10    11    12    16    18    19    21    25    27    25    27    25    27    25    27    25    27    25    27    27    29    27    29    27    29    28    30    29    30    28    29    28    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    28    28    27    28    26    29    28    29    28    29    27    29    28    30    28    30    28    31    27    30    26    30    27    30    27    31    28    32    25    32    28    32    27    32    26    32    23    31    22    32    21    33    20    35    14    31    10    27     8    26     7    24     6    22     8    22     9    20     9    20     8    20     9    20     9    19     9    18     9    17     9    17     8    17     8    16     9    16     9    16     9    15    10    15     9    14    11    14    11    13    12    15    12    16    13    18    13    20    15    21    17    22    16    22    20    25    17    25    16    25    20    25    20    26    18    25    19    25    21    25    21    26    22    26    23    26    23    26    24    26    23    26    23    26    24    26    24    26    24    26    25    26    25    25    26    26    26    26    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    27    28    26    28    27    28    25    26    25    26    25    26    24    26    21    25    20    23    19    21    19    21    13    18     4     6     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                               BLH ATG      69     885                                                                                 
                                               BLH MIN      69     160                                                                                 
                                               BLH OVR      69      42                                                                                 
                                               CDS MIN      69      20                                                                                 
                                               EST CLI      50      20                                                                                 
                                               ORF LNG      69       4                                                                                 
  5   1   2       chi Tad1                            IMAGE:6940047.5p GGGATTTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGTAAGTTAATAATATCACATCATTATTAAAGGAGTCAATGGACTGATCTATGCTGGATTAATAAATACTTGCTTTTACTTGTGTTCCAGGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGGAAAAGACTGTCAAGAAGTTTGCTAATAAGGGAGCAAGGCTTAGCGGGACTCTACTACATCAAGCCTCTAAAACCAAACAGCAGGTTCCTGGTTTACTGTGAAATTTGA
  5   1   2       bld Tad2 5g                         IMAGE:6933421.5p                                 GGGCTACTTCTTGTGCCACCTGGGAGCACATATAACTGCAGGAACCTGCATGCTTCGCTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAACCTTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGGAAAAGACTGTCAAGAAGTTTGCTTAATAAAGGAAGCAAGGCTTAACCGGGACTCTTACTAACATCAAAGCCCTCTAAAAAGCCAAAACAACCAGGTTCCCTGGGTTTACCTGGGGAAAATTGAAACCATTCTGGGCAATTGCCATGGGAACCTTGTTTATTTCCACAAGAAAAAAACCTTTGAATGGGCAATGTGGTGAAAATTTTCCCAATATAAGAAAACTGGGGGGTTCACAGTAAATTT
  5   1   2       bld Tad2 5g                         IMAGE:6933923.5p                                                                   GGGGCAGGAACCTGCATGCTTCGCTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAACAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGAACCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAAAAAATATACAATACCTGCAAGGAAGTATATTCTTCAAATCAAAATAAAATTTTCCTGCCTTAAACAGAAAATACCAAATCTGGAAATTACAATGCCCACCAACCTTGCCCAAGAAACAGTTTAAAATACCTGGAGTTTCACCAGGAAAAAAACTGGCCAAAAATTTGGCTAATTAAGGGAACCAAGGCTTTAACGGAACTCTAACTACATCAAAGCCCTCCTAAAAGCCCAAAACAGCACTTTCCCTGGGTTTAACGGGGGAAAATTGAAAACCACTCCGGCAAGGGGCATAGGAACTGTTTTATTTCaaaaaaaaaaCATTTGATGG
  5   1   2       bld Tad2 5g3  in                    IMAGE:6874166.5p                                                                       CAGGAACCTGCATGCTTCGCTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTANNCGGACTCTACTACATCAAGCCCTCTAAAAGCCCAAACAAGCAANTTCCTGGGGTTTAACTGG
  5   1   2       bld Tad1 5g3  in                    IMAGE:6877243.5p                                                                                          CTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGGTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTTCAAGAAAAACTTTGATGGCAGTGTGAAATTTTCAATAA
  5   1   0       chi Tad2      in                    IMAGE:6871729.5p                                                                                          CTTCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGTATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCAAAATCTCCACGGGGACCGTAGACCCTATGACTCGAAAATCCAAGAACATGAGGAATGAAATTGGCGGGATATGAGGGGAGCAGGATCCGGCATGAGGAAGGGAGAAAGGCGGGAGACAAGAACGGATATGCGTAAGAGGAGGAGATAAGAATGAGGAGCGGGCGTAGGGCGGCGACGGTAgggggggggcgggggAATTGAAGGATGACCAAACGGAAAAGTGCCCAGAGAATAAGGGGGTGCGGAATCCGGGGAGTTCCACAAGGAAAAAGGACCTGAGCGAGGAGAAATTGCGTAAAGTAAGGGAATCGAAAGGCCTTTAGACGGAACCTCTTACCTAACATTCAAGGGCATCCTGAAAAGGCCAAAGCAGACAAGTTCGCTGGAGTTAACTGGTGGAAATTGTGAACCCAATCTGGACAGATGACATGGGACCTGGGTATTCCAAAGCAAAACACTTGATTGGCCCGGTGGGGGAAATTTCCCATAAAGAACCTGGGGG
  5   1   2       bld Tad2 5g                         IMAGE:6934420.5p                                                                                          GGGATTTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAAGGCTTAGCGGACTCTACTACATCAAGCCCTCTAAAAGCCAAACAGCAGTTTCCTGGTTTACTGTGAAATTGNACCATCTGGCAGTGCATGGGACTGTTATTCAAAGAAAGACT
  5   1   2       bld Tad2 5g                         IMAGE:6934413.5p                                                                                           GGGATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAAGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTTCCTGGTTTACTGTGAAAATTGAAACAATCTGGGCAGTGCATGGGACTGTTTATTCCAAGAAAGACTTGATGGGCCAGTGTGAAATTTTCCAT
  5   1   2       bld Tad2 5g                         IMAGE:6871990.5p                                                                                            TCATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGGAGCAAGGCCTTAACGGGACTCCTACTACATTCAAAGGCCTCTTAAAAGGCCCAAAACAGCCAGTTTCCCTGGGTTTTACTGGGTGAAAAATTTGAAAACCAATTCTGGGGCAAGGTGGCCAATGGGGAACCTGGGTTTATATTCTCCaaaaaggaaaaaaaaCCTTTTGGAAAAGGGGGC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6875568.5p                                                                                             ATTTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCCTCTAAAAGCCAAAACAGCAGTTCCCTGGGTTTACTGTGAAAATTGAAACCATCTGGCCAGTGCATGGGACTGGTTATTCAAAGAAAGACTCTGATGGGCAGTGGGGAATTTTCCACTAAGAAACTGGGTCCCAGTAATAGAAGAAAGGTTTTTGGGATATCTTGTCCACCAAAA
  3  -1   2      seed Li1       in                    IMAGE:5130072.3p                                                                                              TTTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAG
  5   1   2       bld Tad2      in                    IMAGE:6876112.5p                                                                                              ATTTCAAAAATTCCAACCAAGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGGAGCAAAGGCTTAGCGGGACTCTACTACCATCAAGCCTCCTTAAAGCCCAAACAGCAAGTTCCCTGGGTTTTACCTGTTGAAAATTGGAACCCATCCTGGGCAGGTGCAATGGNACCTGGTTTATTTCAAAAGGAAGAACTTTGAATGGGGCAAGGTGTTGAAATTTTTCCAATTAAAGAAACTTGGGGTTCCCAGAGTAATAAGGAAAGAAAAGGTGTNTNTGGGGAATAATCCTTGGCCC
  5   1   2       bld Li1  5g3  in                    IMAGE:5130023.5p                                                                                                          CACGCGTTCGGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTAC
  5   1   2       bld Li1  5g3  in                    IMAGE:3398150.5p                                                                                                                 AGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACaaatatgaaaaaactattatccagtatgaaaaaaatatacaatacctgcaaaaaatatatTCTTCAAATCAAAATAAGATTTTCCTGCTTGAACAGAAAATAGCAAATCTAGAATTACAATGCCAAGCACCTTACCAAAATACAGTTCAGATACAAGAATTCACAAGAAAAAACTGTCAATAATTTACTGATAAAGAANCAAAGCTTAGCAGACTCTACTACATCAAAGCCTCTAAA
  5   1   2       bld Li1  5g                         IMAGE:5129778.5p                                                                                                                 AGAGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTAC
  5   1   2       bld Li1       in                    IMAGE:3396423.5p                                                                                                                  AGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCNTTTTCCCGATTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTTAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCA
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057003.5p                                                                                                                   AGGGTGCAGGGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCACATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAGATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACATGAAAAGACTGTCAAGAAGTTGCTAATAATGGAGCGAGGCTT
  5   1   2       add Li1  5g                         IMAGE:3397645.5p                                                                                                                    GGGTGCAAGGACATAGGACCTGCCATAATGACCATACTTCCCAAGCAAGGATTACTGATTTTCCACTCCTTAACCCTCCTCTCTAGTGCCTTTGGTCATATTATACCAAACACACACAACTGCTGCATCTTAGATGGACCTTATGGGGAGTACTGCCCTACAACATGCAGCATTTCCGATTACCTGAACAGATACCAAGAAAATGTTGACACAAACTTGCAGGACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTG
  5   1   2       bld Li1  5g                         IMAGE:3397186.5p                                                                                                                            GGACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACCAGAATTCACATGACAAGACTGTTCAGAAATTACTAATAAAGGAACAAAGCTTANCAGACTCTACTACATCAATCCTCTAAAANCCGAAACAGCATTT
  5   1   2       bld Li1  5g3  in                    IMAGE:3397543.5p                                                                                                                              ACATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTCTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACCAGAGTTCACAGGAAAAGAACTGTCAGAAGTTGCTAATAAGGGAGCAAGGCCTAGCGGACTCTACTACATCAAGCCCTCTAAAGCCAAA
  5   1   2       bld Li1  5g3  in                    IMAGE:5130073.5p                                                                                                                               CATAGGACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTT
  5   1   2       bld Li1  5g3  in                    IMAGE:3396861.5p                                                                                                                                     ACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTGTCCTGCTTAAACAGAAAATAGCAAATCCTGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCCAGAAGTTGCTAATGAAGGGAGCAAG
  5   1   2       bld Li1  5g                         IMAGE:5129425.5p                                                                                                                                     ACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGG
  5   1   2       bld Li1  5g                         IMAGE:5129811.5p                                                                                                                                     ACCTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCG
  5   1   2       bld Li1  5g3  in                    IMAGE:5129599.5p                                                                                                                                       CTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGAC
  5   1   2       bld Li1  5g3  in                    IMAGE:5129888.5p                                                                                                                                       CTGCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACAT
  5   1   2       bld Li1  5g3  in                    IMAGE:5129849.5p                                                                                                                                         GCCATAATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAG
  5   1   0       chi Tad1                            IMAGE:6937728.5p                                                                                                                                                                                                                 GGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATNGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTTACCTGGGAAAACCCTTTTTAACTCAAATCAGCCAACTTCCCCAAGTGGGAACCTCCCTTAATAGTagaaacttttaaaaaaccccggggaaaaaaacctggaaaattttccccaaaacaggccctagaacccccttgaaccccaaaaaattccaaaaaaCCTGGTTTGGGAATGAAAATTTTACCCGGTTATTGGaaaaaaaaccttttttttcccccttttttggagaaaaaaaattttttcccgtttcccccgcgacaaaaaaatttttttttcttctccaaaatctcccaaaaaattcaaacattttttttCCCCCGGCGGGTCTTTAAAACCCGGGAAAAAATATTTTCCGCAAATCTCCggggggggTTTTTCTCAAAAGGTGTCCCCGCATAAATCTCTTTTTTTTTCGCCaaaaaaaaaaaaaaCTTTTTTCTTTAAAAAAATAAACGGGAGGGGTTTCTTCCCCCCCCGGGGGGaaaaaaaaaaaactattcgtctactaaaaaaaaaGCCGCCGTTCCCCCCCATAACGCGGGCCGTGGCAACATGCGCGGTGTTTCTTTATAACGCACGAAAAACCTTACCCCATCATATCAAACACAAACGACCCCCCTCCTCCTACTAAAAGGAAAGGGCGGGACTCTAACAGACGGGGGCGCTCGGCCTCCCTGCGGCTCGGGGTTTCCTTGCTTATCCGTGGGGCGAATTAGTGTACGCCTATTCCCCACCCCACCTCCCGTTCCCATCTGGATGTCGCCCGATAGCCTGTATT
  5   1   2       bld Tad2      in                    IMAGE:6875888.5p                                                                                                                                                                                                                   TAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAAGGTTTTGGATATCTGTCACCCAAACGACAAGACTGAGNTTCTGGGCTTGGGGAATGaaaaaaaaTACAATTCTACTAAAGCACCCAATCCTACCCATCCCCATAATGG
  5   1   2       bld Tad2      in                    IMAGE:6875476.5p                                                                                                                                                                                                                                       ACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAAGTTTTTGGATATCTGTCACCAAACGACAAGGACTGAGTTTTCTGGCTTTGGGAAATGAAAAAAATACATTCTTACTTAAAGCACCCCAATTCTACCCATCCCCCATATTGGN
  5   1   2       bld Emb4                            IMAGE:4959181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATAGATCCCCAGACTCAGAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACGATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAACAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGGGATACAGTTCAAATTCAGGATTTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAAGGAGCAAGGGTTAGTGGACTCTACTACATCAAACCTCTGAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGCGCATGGACTGTTATTCAGAGAAGACTTGATGGTAGTGTGGATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGAAATGAAAAAATACATCTAATAAGCACTCAATCTGCCATCCCATATGTTTTGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGGTATTTAAAAGACTATGGGGCAAATTTACTGAAGGGCGAA
  5   1   2       bld Tad2                            IMAGE:6935304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGGGAAACGACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATGATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACATGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGAAATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAGAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGGAGATGATCCAAGTGATAAATTCTACACATCCTCACAATGGAAATGCCAGTTCAACTACTTTTTGGAATAAAGACAGATGGACCAAGTTTTGGACGGGAAAACTTGTGGCCTTAAGCCAAAGAATGGGCCTCCTGGGGNTGGGGTGGGAAATGAAACCCGAAATTGCCCCATTGCCAACCCCCCCACC
  3   1   2       chi Tad2      in                    IMAGE:6876112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAGAAAAGCTCTTTTTGCCAAAAAAAATACAATTTTTCAAAGATAACAAGGGAGTTTTCCCCCATAAAAAAAGGGCCCTTTCAAAAAAAAGTTTGGTTAAAATAAAGGGGAGNTTCNAATAAATTTTTTATATTATATTAGAAGGAAAGAAAANGGAGNTTGGATATTTATTAAGCACATACCATACGTTTGGTCCCGTTCCTAGTGGTGGTGCNCCCGGAAGGNNNTGCTGCAGATGTAATTTTTTTTAAGGGGAAGGATTTGGAGTGCAGTTTTTGAATTTTTCGGGNAAGAAAAGTGGTTTCCATTTATAGGAGAAAGTTTTTTTGGATAATTTGTCAACCAAAANGACAAAGANTTGAGTTTTGGGCTTGGGAAATGAAAAAATACATTTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGCTGAACCGATGCCATGCAGCCCACCTCAATGGTAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAAGGACAGCAGACTTTGGGCCTNAAANAAAATTTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAACAAnAAAAGGAAAAAAAnnAAACAAAnnAnnGnCnnGCnnnAAAAAAGAAAGACACAACAGGnAnAAAnnACAGnAAAAGAAGGAGAAAnAAAAAAACCACCCCCCCCCCCCCCCCCCC
  5   1   2       bld Li1       in                    IMAGE:3398095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAAAAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCA
  3   1   2       chi Tad2      in                    IMAGE:6875476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTTTAATATTTAAACGGGCGCAACGCCCCACAGGGTTCTTTTTCTCGGCCGGGACCCTTCTCTACCTCTCCCTCTTCCCAGAGCCCCTCTTTAAGAAATCGCCCCAACACCGAGCCCATGTTTCGGGTGGTTTTCACCCCTTCTGCAACTTTGACACCCCATTTTGGGCCAGTTGCCATGGGCACTTGTTTATTTCCCAAAGAAAGCCCCTTCATTGCTCCAGTTGTGAATTTTCCCATTAAGCAACCCTGGGTTCCCAGTATAGAGGAAAGGTTTTTGGGATATCTGTCCCCCAAACGCCAAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATTTACCATCCCATATGTTATGAGAATCGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCAGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAAGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTAGAAAACAGAGGAGACTATTAAGAATCCAGCTTTTGGATCATTATTTGACACACAATTGTCTTGCTCCACAAATTGTTTGCACAAATNNNCCTCCCCCGGGGGCCGGCCTTAAANNNTGCCCCCCCCCCCCCCCCCCCCCCCNNNNNCCCCNNNNCCCC
  3   1   2       bld Tad2      in                    IMAGE:6875888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGTTCACAGAAAAAGACTGTCAAGAAGGTTGCTAATAAGGGAGCAAGGGTTTAGCGGACTCTACTACATCCAAGCCTCTAAAAGCCCAAACAGCAGTTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTCCTTTATAAATTGTATCA
  3   1   2       bld Tad2      in                    IMAGE:6871729.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTAAAAAAGAGGGGGCCCTTTTTTATTGGCCCCCCCGTGGGGAAAAAATTTTCCCCAAAAAAAAAAAAACGGGGGGTCCCCCCCGTTTTTGGGGAGAAAAGGTTTTTTTGGAAATATTTTTTGTTCCCCCCCAAAAAGGGCCCAAAGGGGTGGGGTTTTTCGGGGCTGTGGGGGAATTTGAAAAAAAAAACCCCTTTTTTTTAAAGGCCCCCCCAATTTTTTCCCTTTCCCCAATTATGTTTTTTTGGGAAAATTGGGGTTTTAAAAAGGGACTTGGGGTTAATTCAAAAAGGGGCCCCCAGCCGGGGTTTTTTCCCAATTTTAAAGAACGGGGTTTTCAAAAAAAGGGATAAATTTTCCGTTTTAATTTAAGGCATAATTTCATTGGGTGGGGGATGCCGGGTGGATGCCTTTGAAGGGGTTTGACTTTGGGAGATGATCCAAAGTGATAAATTNCTACACATCTTCACAATGGAATGCAGTTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTC
  3   1   2       bld Tad2 5g3  in                    IMAGE:6875568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGGCCAAAGGGTCTTAGAGGCGGGAACTTCTTACTTACATTCCAAGGCCTTCTAAAAAGGCCAAAACCAGCCAGTTTCCTGGGTTTACTGGTGAAAATTGAAACCATCCTGGCAGGTGCATGGACTGTTATTCAAAGGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTTGGG
  3   1   2       bld Tad1 5g3  in                    IMAGE:6877243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGCAAAGGGCTTTAGGCGGAACTCTTATAAACAATCAAGCCTTTAAAAAGCCCAAACAGGCAGTTTCCTGGTTAACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTATAA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6874166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAGGGGAGCAAGGGTTTAGGGGAACTTTAATACATCCAAGCCTCTAAAAGCCCAAACAGCAGTTCCTGGTTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAAGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATGTATTCACA
  5   1   2       bld Li1                             IMAGE:3396452.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGTATAGAGAAGGTTTTGGATATCTGTCACCAAACGACAAGACTGAGTTCTGGCTTGGGAATGAAAAAATACATCTACTAAGCACCCAATCTACCATCCCATATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACCGGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAA
  3   1   2       bld Lu1  5g3  in                    IMAGE:4057003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTTCTGCTTGGAAATATAAAATCATCTANTAAGCACCCAATCCACCCATTCCATTATGTTATGAGAATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAAGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAA
  3   1   2       bld Li1                             IMAGE:5130332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGAATGATCCAAAGTGATAAATTTTACACATTCTCANCAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGAATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCA
  3   1   2       bld Li1                             IMAGE:3398485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGACTGGAGTAATCAAAAGAGCACAGCAGACTATTCCACTTCAAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAA
  3   1   2       bld Li1  5g3  in                    IMAGE:3398150.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAAGACTGAGTTATCAAAAAGCCCAGCAGACTATCCACTTTCAGATTGGGTTCAGAAAAGAATAATATTCGTTTAACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATTTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCCCAACTTGTTTTTAAATAAAGATACCCCATTGTGAAAAAAAAAAAAA
  3   1   2       bld Li1  5g3  in                    IMAGE:3396861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAGTTATCAAAAGAGCACAGCAGCTTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGAGGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTATAAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAAA
  3   1   2       bld Li1  5g3  in                    IMAGE:5129849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTAATCAAAAGAGCACAGCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAAA
  3   1   2       bld Li1                             IMAGE:3396770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCACACCAGCTCATTCCTCTTTACGACTGCGTTCAGAAAAGTATAATTATCGTTTTACTTACGCACACTTCATTGGTGGTCACCCGGGTCATGCCTTAGATGGGTTTACTTTGCGAGATGATCCCAGTGATATATTCAACACTTCTCACAATGGAATCCAGTTCAGTACTTTTGATACAGACAATGACAAGTTTGACGGACACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCTATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGCACAA
  3   1   2       bld Li1  5g3  in                    IMAGE:5130073.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGACTATTCCACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGAA
  3   1   2       bld Li1  5g3  in                    IMAGE:5129888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGAATGATCCAAGTTGATAAATTCTACACATCTCNACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTG
  3   1   2       bld Li1  5g3  in                    IMAGE:5130023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATCCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGCCCAAAAAAAAAAAAA
  3   1   2       bld Li1                             IMAGE:5129513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAGACTGGGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAA
  3   1   2       bld Li1  5g3  in                    IMAGE:5129599.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTCAGAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGCCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAA
  5  -1   2       bld Li1       in                    IMAGE:5130072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAGGATAATTATCGTTTTACTTACGCATACTTCATTGGTGGGGATGCCGGTGATGCCTTTGAAGGGTTTGACTTTGGAGATGATCCAAGTGATAAATTTTACCCATTTCCCAATGGAATGCAGTTCAGTTCTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTTTGGGTGGTGGATGAACCGATGCCATGCAGCCCCCCTCAATGGCAAATTCTATCAAGGAGGTACATTCAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATTTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTTCAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTTTGACTTTGAAAACAGAGGAGACT
  3   1   2       bld Li1  5g3  in                    IMAGE:3397543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACTTCATTGGTGGTGATGCGCGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATANATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAA
  3   1   2       bld Li1       in                    IMAGE:3398095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACTTCATTGGTGGTGATGCGGTGAATGCCTTTAAGGGGTTTGACTTAGGAGATGATCCAAGTGATAAATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAA
  3   1   2       bld Li1                             IMAGE:3397111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACTTCATTGGTGGTGATGCCGGTGATGCCTTTGATGGGTTTGACTTTGGAGATGATCCAAGTGATANATTCTACACATCTCACAATGGAATGCAGTTCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAA
  3   1   2       chi Li1       in                    IMAGE:3396423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGGCATGACCCCACGTGCTCACTCCTACCCTCCTCCCCATGGCGCCCCGCCCCGCCCTTCGCATAAAGCCCCCGCCCCGTTCGCCCCAAACTGTGCCGAGCCCGATGGCTCTGGGTGGTGGATGAACCATTGCCATTCAGCCCACCTCCATGGCCAATACCATCAAGGAGGTACATACAGTGAGGCGGCCAGTGGACCTAACGGCTATGATAATGGTATTATTTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAAAAGTTTGACTTTGAAAACAGAGGAGACT
  5   1   2       bld Tad2                            IMAGE:6935030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTACTTTTGATAAAGACAATGACAAGTTTGACGGAAACTGTGCTGAGCAAGATGGCTCTGGGTGGTGGATGAACCGATGCCATGCAGCCCACCTCAATGGCAAATACTATCAAGGAGGTACATACAGTGAGGCGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAAGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCAAANaaaaaaaaaaaaaaaaaaaaaaaaaCATGTC
  5   1   2       bld Li1       in                    IMAGE:5129531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACAGTGGACCTAGCGGCTATGATAATGGTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Li1                             IMAGE:3398357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCCCAACTTGTTTTTAAATAAAGATACCCCCTTGTGAAAAAAAAAAAA
  3   1   2       bld Li1       in                    IMAGE:5129531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTATTATCTGGGCTACCTGGAGAAGCCGGTGGTACTCCATGAAGTCAGTTACAATGAAAATCATTCCCCTTAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAAAACAGAGGAGACTTTTAAGAATCCAGCTTTTGGATTATTATTTTACACTTTATTGTCTTGCTTTATAAATTGTATTCACAACTTGTTTTTAAATAAAGATACACCATTGTGAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)