Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7393669.5                       5 END     1           1       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3378076-IMAGp.5                 5 PI      88       2211     2873                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4032826.5                       3 PI      94        143      816                hypothetical protein LOC432344 [Xenopus laevis]

 This cluster: approximate FL confidence score = 67%

 1012768937 Xl3.1-IMAGE:4032215-IMAGp.5 - 76 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4032215-IMAGp.5               CGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAAGGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTGCTGAATAGCACACTATGCGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACAAAAAGTTTAAGTCTTGAAATACAGCCTGAGGACTCTCTTGAAAGGGTCATGTCTCCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCCTTAAATAAAATTGACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685928                     GTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAxxGxxxAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTGCTGAATAGCACACTATGCGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACAAAAAGTTTAAGTCTTGAAATACAGCCTGAGGACTCTCTTGAAAGGGTCATGTCTCCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCxTxAAxTAAAATTGACTGTGAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                    5     5     6     6     8     9     8     9    10    11    12    16    12    16    16    17    18    21    23    26    25    26    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    26    27    27    28    27    28    28    29    28    29    28    29    28    29    28    29    27    29    28    30    27    29    27    29    25    30    26    30    24    29    25    29    22    27    21    26    19    24    19    24    19    24    17    21    16    20    16    20    16    20    16    20    15    19    15    19    14    18    14    17    13    16    13    16    12    15     7    13     5    13     4    14     4    14     4    14     4    13     4    13     5    13     5    13     5    13     5    13     5    12     4    10     4     9     4     8     4     7     4     7     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     2     4     2     4     3     4     2     4     3     4     3     4     3     4     3     3     4     4     4     4     4     4     3     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     9     9     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     9     8     9     9    10     9    10     9    10    10    11    10    11    10    11    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    12    13    12    13    12    13    12    12    13    13    12    13    13    13    13    13    13    13    11    12    12    13    12    13    10    12    10    13     8    12     8    13     8    12     9    13     9    13     7    13     9    14     9    15     9    15     9    15     9    15     8    15    11    19    12    20    12    20    12    20    11    20     8    20     8    20     9    20    11    22    11    21    13    22    13    23    16    23    15    23    15    21    18    25    20    26    20    25    20    25    19    25    20    25    20    25    21    25    22    25    22    25    22    25    22    25    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    22    21    22    21    22    21    21    21    21    22    22    22    22    21    21    21    21    20    21    20    21    24    25    24    25    25    26    23    26    24    26    24    25    23    24    20    24    21    24    18    23    17    21    11    19     9    17     6    12     2     7     2     7     3     3     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTTTCAAAAA
                                                                   SNP                                                                                                               ------G-----
                                                                   SNP                                                                                                                           -------C----
                                                                   SNP                                                                                                                                       ----------G-
                                                                   SNP                                                                                                                                                                                                                           --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------C----T
                                               BLH ATG     162      81               
                                               BLH MIN     806     250               
                                               BLH MPR      96      12               
                                               BLH OVR      90     100               
                                               CDS MIN      90       2               
                                               EST CLI      20       2               
  5   1   2       bld Ga12 5g3  in                         XL175d14.5p GCTAAGGCGTGACGCGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCC
  3  -1   2       bld Ov1                             IMAGE:5048655.3p   CTAGAACTAGTGCGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTT
  5   1   2       bld Egg3 5g                         IMAGE:3377730.5p         CCGGGGCGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGGTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTT
  5   1   2       bld Oo1  5g                         IMAGE:5078782.5p            ACGCGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTANAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAAACTGGAAATAATGCTAGAAGAAAATGTCTCGCTTTCCAGCAATGGGTAAATTATATACAAAGGTAATCAACTGGGGTTCAGCGGAGCATAATGGGAGGATGGTGGAAATCTGGATGCCCCTAATGGGAGAAGGACCAACTTTGGTATTACTCAGCTGAACAACAATGGCTTTGATGGGAAGGTCCTCTTTGTGGAGCATACCGAAAGCACCTGAAAGACAATATTCCAT
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402159.5p               CGTGCTGTTGCTAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTANAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGATACACGTGTGTGGAGATGACTTAATATCAATAATAGATGCTCAGAGCGGTATGTCTTGCCGTAATATAGTAACA
  5   1   2       bld Ga12 5g3  in                         XL175g16.5p                          GAGGCAGTGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAAT
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402194.5p                             CACGCGTCCGCGGACGCGTGGGGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCCTCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCGTCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCACACATAGATGCTCAGAGCGGTATCTCTTGCCGTAATTTTGTAACA
  5   1   2       bld Ga12 5g3  in                         XL191p22.5p                                 TGAACGCGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAG
  5   1   2       bld Tbd7 5g                              XL091g11.5p                                   ACGAGGCGCGTTCTAGCGAGTGATAGTGCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCGTCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCC
  5   1   2       bld Kid  5g                         IMAGE:4032215.5p                                                              GCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTANACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGGAGAATGGTGAAAATCTGGATGCCCCTACTGGGAAGAGGTACCAAACTTTTGTATTTACTCCAGCCTGACCACCAAGTTTGGCTTGGATTGGCAGGTTCCTCTTTGGGTGGAGGCATACCCGGAAAGCACCATTGTAAAGGACCAATTAATT
  5   1   2       bld Kid  5g                IMAGE:4032215-IMAGp.IMAGp                                                              GCTGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAAATCTGGGATGCCCCTAAATGGAAGAGGTACAAACTTTGTATTACTCAGCTGACCACAAAGTTGCTTTGATGGGCAGTTTCTCTTGGGTGAGCATACCGGAAGC
  5   1   2       bld Kid  5g                         IMAGE:4032207.5p                                                                TGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTANACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGGAAAATGGTTGAAAATCTGGGATGCCCCTAATGGGAAGAAGGTACAAAACTTTTGTATTTACTCCACGCTGACCCACACAGTTGGCCTTGATGGGCAGGTTCCTCTTGGGTTGGAGCATACCCCGAAAGCACCATGTAAGGACAANTATTGCCAATTTAATTTTCCCGGAA
  5   1   2       bld Kid  5g                         IMAGE:4032210.5p                                                                TGCTGGCGCCATCTCTTTGGTTTGGCGCGCTCCAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTANACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGANNATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGTACAAACTTTTGTATTACTCAGCTGACCACAAGTTTGCTTGATGGCAGNTTCTCTTGGGTGAGCATACCCGAAAGCACTTGGAAGACAATATTACCATTTAATTTCAGAAN
  5   1   2       bld Oo1  5g                         IMAGE:6643690.5p                                                                     GCTGGACCGGTCCGGAATTCTGCGATCCAGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTANACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAAGAGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACCATATACCATTAATATCCGAAAAAGCCCCCACCGTGAAAACCAACCATAAGATTCTCCATTAGCAGCTCATCTTGAAA
  5   1   2       chi Ov1       in                    IMAGE:5074710.5p                                                                       GACCCACGCGTCCGCAAGTCTCCTGGGTGTTGGGGCTGCTAGTGAGATGAGGTATTTCCGCTGAGTTGTACTTACAGGCTTCATGAAATCAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTG
  5   1   2       bld Ga12 5g3  in                         XL168f09.5p                                                                        GGCCTCTCTTTGGTTTGGCGCGCTCCGTGTGGGATGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAAT
  5   1   2       bld Ov1  5g                         IMAGE:8331104.5p                                                                                                CAGTGTGGGATGCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAG
  5   1   2       bld Egg3                            IMAGE:6868149.5p                                                                                                          TGCAGTGTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGTACAAACTTTGTATTACTCAGCTGACCACAATTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTTCAGAAAAAGTCCCCACGGGAAAACAACCCTAAGAATCTCATTAGCAGCCTCATCCTGG
  5   1   2       bld Emb1                            IMAGE:6635675.5p                                                                                                           GCAGTGTAGATCTGTGGCATCGGTCAGCTTCTCGTTACGGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCGTCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGGTTCAGCGGAGCATATGGGGAGGAATGGTGAAAAATCTGGAATGGCCCTAATTGGAAAGAAGGTAACAAAACTTTTGTTAATTACTTCAAGCCTGGACCCACCAAAGTTGGCCTTTTGAAATGGGGCCAGGTTTCCTCCTTTggggggggAACCCC
  5   1   2       bld Ga12      in                         XL169g11.5p                                                                                                            CGAGGGTAGAGCTGTGGCNTCGGCCGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTNCCA
  5   1   2       bld Ga12      in                         XL219a21.5p                                                                                                               GGCACGAGGGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTT
  5   1   2       bld Ga12      in                         XL187f05.5p                                                                                                                GTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCCAACTGG
  5   1   2      seed Ga12      in                         XL190p24.5p                                                                                                                GTAGAGCTGTGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGG
  5   1   2       bld Ga12      in                         XL147k04.5p                                                                                                                        GGTGGCATCGGCCGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTA
  5   1   2       bld Ga12      in                         XL206p11.5p                                                                                                                         TGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGCTCAGATTTGATGATTTGAATCCAGNAAGCAGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATC
  5   1   2       chi DMZ       out                        xl263a01.5p                                                                                                                         TGGCATCGGCCAGCTTCTCGTTACCGTGTCGGGAGTCGCAAGGTGTACACAGGAAAATGATTCCTAACGGATCTTTAAATTTTGAAGATGAACAATTTATCGAGTCATCTGTGGCTAAATTAAATGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAATGAAGATACCTCAAGGTTTAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCGCTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTCTGTGACATGTACAATCTACGTTT
  5   1   2       bld Tbd7                                 XL053b11.5p                                                                                                                                                                                                                                                     TGCCTTGCGTAAAAGCGGACAGTTTTGTGATGTCAAACTACAGGTCTGCGGCCATGAAATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTCAACAGCGACAGTGAATCTAATGGCATTTCCCTTGTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGNAAAATTGACAATTACATT
  5   1   2       bld Oo1       in                    IMAGE:3404484.5p                                                                                                                                                                                                                                                                                                                                                                                                         GTCAGATTTGATGATTTGAATCCAGAAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTTAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAACTAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGC
  5   1   2       bld Ga18      in                       xlk62h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCTGTTGAAGTTTTATTAAATTATGCATACACATCTCAGCTTAAAGCTGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAACTTAAGATTGATCGAGTGAAANAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCNNNNNNATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTNNTGAATAGCANNCTATGCGTTATATTCCTGCATGGNCGAAACANCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACNAAAAGTTNNA
  5   1   2       bld Sp1       in                    IMAGE:4173247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAACTTTGTTTTACTAATGTATATTGAAAGTATCTTGTATGTGTCCTTGTATACATCTTTGCTTCTGTCATCTCTCGTATCtccttttctttactttttattcctgtatctttttttttcttctttctttcttttttGTGTTTAACGCCTTCACCCCTACCTATTGGAAAATGAAGATTTCTTCAGGAAGACTTGAGTAATTAGAAGATTCTGACATCATGCAATATAAttttttttttttAATTGAAAGTTCGAACACAATGAAGATAACATGGAATACAGGATCACAAATTAAACATTTTTAGAAGTAGTATCCATATGCCTGTTTCATTCCTATTTTGCAGGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCANAGCATGAATGGAAATTATTGCATCAGAAAAGAAAACAAATATACCTATCTGTGTTAGCTGTGCTG
  5   1   2       bld Kid                             IMAGE:7009383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGAGTGAAACAGGTGTGTGGAGATTACTTAATATCAAAAATAGATGCTCAGAGCGGTATTTCTTGCCGTAATTTTGTTAACACAATGGGAGATTGGCGCCTTTTAACTAAAATTGACAATTACATTCAGGAGCACCTTCTTGAGATTTCTGAGCAGGATGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTCTCGCTTCCCAGCAATGGTAAATTATATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTGCTGAATAGCACACTATGCGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACAAAAAGTTAAGTCTTGAAATACAGCCTGAGGACTCTCTTGAAAGGGTCATGGTCTCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATGCA
  5   1   2       bld Emb1                            IMAGE:6631353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCATATGGGAGAATGGTGAAAATCTGGATGCCCTAATGGAAGAGGACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTGCTGAATAGCACACTATGCGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACAAAAAGTTTAAGTCTTGAAATACAGCCTGAGGACTCTCTTGAAAGGGTCATGTCTCCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGGTGTGGAGAAAAGTATGATCCCAAATCAAACATCTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGGAGTGTGCTCTCAATGGAAACTTATATGGTTGTGGGGAGGGTCAGATTCATATGGCCAGAAAGGGCTTAAAAACTGGGGACGTGGTTTAACCCCATAACAAGGATGTGGGACATGTTGG
  5   1   2       bld Gas5                            IMAGE:3748334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAATTCCTGAAAATCTGGATGCCCTAATGGAAGAGGTACAAACTTTGTATTACTCAGCTGACCACAAGTTGCTTGATGGCAGTTCTCTTGGTGAGCATACCGAAGCACATGAAGACAATATACAATTAATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTCATTAGCAGCTCATCTGGATCTCTGTCTCCTAGTGCCCTGATTCAGTGTCCAAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTATCTGTGTTTAGCTGTGCTGAATAGCACACTATGCGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCAAGCACCCCTAGATTGACAAAAAGTTTAAGTCTTGAAATACAGCCTGAGGACTCTCTTGAAAGGGTCATGTCTCCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCATGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGATAACACCAAGAGCCCGTTTGCAAATGGCAGTTCTGATGGACCATCTATATGTTGATGGAGGATCAAATGGTCACTCTGAT
  5   1   2       bld Oo1                             IMAGE:5078932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTCTTGAAATACAGCCTGATGACTCTCTTGAAAGGGTCATGTCTCCCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGGAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGGCAGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAAGGTGGTTTTTGATGGCAATGAATTCTTAAATACAGTTGAAAGTTATAACCCTCAGACAAGATGGATGGGAGTCCATTTTACACAACTGGGCCAAATCCTAGTTAT
  5   1   2       bld DMZ       in                         xl286a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATGCATTACGCTCGGTCTGGTCTAGGAACAGCAGAATTAAATGGCAAACTCATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCG
  5   1   2       bld DMZ                                  xl319h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGC
  5   1   2       bld DMZ                                  xl244l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGT
  5   1   2       bld DMZ                                  xl253f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACAGTTGAGTGCTATGATCTAGAGACAGACATTTGGACCTTTATTGCACCCATGAAAACACCAAGAGCCCGTTTCCAAATGGCAGTTCTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTT
  5   1   2       bld Ga12      in                         XL211j18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGATGGACCATCTATATGTTGTTGGAGGATCAAATGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGAAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCT
  5   1   2       bld Egg1                               PBX0142F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGAGGGGTCACTCTGATGATCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACATTTGGACACCTGTTCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATA
  5   1   2       bld Tad1      in                    IMAGE:6880543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCTGAACTAAGAAGCAACCGTTGTAATGCTGGGGTGTGTGCTCTCAATGGAAACTTATATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTTGTGTACCAGCAACGTCcatttttgcatattgcatatttttcaaaaaagttgtaaataccttctttttcattttatttGNAAAGAAAGGNATGTTCTTTAA
  5   1   2       bld Tad1      in                    IMAGE:6878090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTATGTTGTGGGAGGTTCAGATCCATATGGCCAGAAAGGTCTTAAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACCACTGTGCGAAATCCTAGTAATGCTTTTCTCACACTGATGCAATTTACAGCCTTTGAATGGGACCTTAAAGTCCCCTCCAGGTTTGGTGGGTGGGAACCAAACAAACGGTCCATTTTTTTGGCCATATTGGCCATATTTTTTCaaaaaaaaaaGTTGGGAAAAAACCCTTCCCCTTTTTTCCATTTAATTTGGGGAAAA
  5   1   2       bld Lmb1                            IMAGE:8531748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGGTCTTAAAACTGTGACGTGTTTAACCCAATAACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTCTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACAGGGAttttttttttCTTATCCGCAAGCATTCT
  5   1   2       bld DMZ       in                         xl272l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGtccatttttgcatattgcatattttcaaaaaaagttgtaaatacttttttcatttatttGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAtttttttattttATTCCGCAAGCATTCTTGTG
  5   1   2       bld DMZ                                  xl273l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAAGGATGTGGACATGTTGCGCCCAGCTAAACATTAGAAGGCACCAGCCTGCTGTTTGTGAATTGGGCAACAAAATATACATCATTGGAGGAGCTGAATCTTGGAATTGTCTTAATTCGGTAGAATGTTACAATCCACAAAATGACACCTGGACATTGGTGGCGCCTATGAACGTGGCTCGACGTGGTTCCGGTGTTGCTGTTTATGATGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGtccatttttgcatattgcatattttcaaaaaaagttgtaaatacttttttcatttatttGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAtttttttattttATTCCGCAAGCATTCTGGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTG
  5   1   2       bld Brn1                            IMAGE:7018908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAAGCTATTAGTGGTTGGCGGTTTTGATGGTACCCATGCTCTATGTTGTGTCGAATCATACAACCCTGAAAGAAACGAGTGGAAGATGGTGGGCAGTATGACATCTTCAAGAAGCAATGCAGGAGTGGTAGCTGTAGGAAATCAAATCTATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAGTTGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTCTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAttttttttttCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGAtttttttttCTTTACTATAAAATAATGTGCTTAAAAAGCCTTACTGAATCAATATTTTTTGAGTAAAAGAAGTGCAGGTATGCCCAAAACACGCACCTTTTGGGAATGCCCTTTTTTATTACTGGTTTTAAAAACTCCGGCGGCCGGCACCAATAAATTTTCCAACACCTTTATAAAAGGGGCTTATTTCTTTGAAGACCTTTTCCCAAAGCTTTTTTGAATTTTTGAAAA
  5   1   2       bld Egg1                               PBX0151A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGAGGACGACCCTGAAAGAAATGAGTGGAAGATGGTGGGGAGTATGACATCTTCAAGAAGCAATGCAGGAATGGTAGCTGTAGGAAATTATATATATGCTGCAGGTGGTTTTGATGGAAATGAATTCTTAAATACAATCGAAGTTTATAACCCTCGGACAGATGAGTGGAGTCCATTTACACAACTGTGTGAATCCTAGTACTCATTTCTCACACTGATGCAATTCACAGATCTGCTTGGGCTTAAGTCCCTCATATTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGCTGTAAATACAttttttttttttCATTTATTTGTAAGAAGGAAAGGTTTAAATAACTTGTGCTAACTGTAATTACTCTACTGTGGAATTCTATGAAAACCAGGGAttttttttttCTTTCGGCAAGCATTGTTATGTATATGTTGTCTCTGTTCCTATTGCACTGACATGTAGAGCTTCAGTTAATGAGTAGTTACAAAATCTTACATGGTTTTAATTGAATGCAAGTGAttttttttttCTTTAGTATAAAATAATGTGCATAAAAGCCTTACTGAATCAATATTTTTGAG
  3   1   2       bld Tad1      in                    IMAGE:6880543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NTTATTAAACCCCTCTTCAGGCACAAGAGATGAGAGGTGGGGAGGTCTCCCTTTTTTACCACCAAAACTTGTGGGGGAAATTCCTAAGGTTAAAGGGCTGTTCCTCCACCACCTGGATGGCAAATTTCCACCAGCCTTTTGAATTGGGAACTTAAGGTCCCCTTCATGGTTTTGGTGGTTGTACCAAGCAAACGGTCCATTTTTTGCATTATGGCATATTTTCCAAAAAAGGTTGTAAATACTTTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATACTGGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTTTTCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTTCTGTTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCGACGATATTTTATCATCTAAAAGAAATAAAAAGCGGCGAAT
  3   1   2       bld Tad1      in                    IMAGE:6878090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAAGGGGGGGGGAGGTCCCCATTTTAACCAAAATGGGGGGGGAAATCCCCAGGAAAAGGCCTTCTTCCCCACGGGAGGCAAATTTCCCCGGTTTGAATTGGACCTTAAATTCCCCCCCAGGTTTGGTTGTTGTTCCCAAGGAAAGGTCCCATTTTTTGCCATATTGCCATTATTTTCCAAAAAAAAAGTTGGAAAATACTTTCTTTTTCATTTTATTTGGTAAGAAAGGGAAGGTTTTAAAATAACCTGCTAAACTTGGTAATTGTTCTACTGGGGGATTTCTATGAAAACCCAGGGATTTTTTTTTCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCGGCAATA
  5   1   2       bld Egg1                               PBX0049G04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCGGAACGAGGAAGTTTATAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTCTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAttttttttttCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGAtttttttttCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTG
  5   1   2       bld Egg1                               PBX0140D02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGAGGAGTTTATTAACCCTCAGACAGATGAGTGGAGTCCATTTACACAACTGTGCGAATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTCTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAttttttttttCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGAttttttttttCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCC
  3   1   2       bld DMZ       in                         xl286a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGACAGANGAGTGGAGTCCATTTACACAACTGTGCGGATCCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGTACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGG
  3   1   2       bld Ga12      in                         XL169g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTAGTAATGCTTTCTCACACTGATGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAAAAAAAGC
  3   1   2       bld Ga18      in                       xlk62h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANGNTTNNTCACACTGATGNNNTTCACANNTTTGATTGGACNNAANNNCCTCNNNTTNGTTGTTGTNCCAGCANCGTCCATTTTTGCATATTGCATATTTCAAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGNANCCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATNGNCTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAANTCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGANCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTNNNNNNTNCTCACTTGTAATGTACATNNC
  5   1   2       bld Egg1                               PBX0053D09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGAGGGCAATTCACAGCTTTGATTGGACTTAAGTCCCTCATGTTTGTTGTTGTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTCTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGAtttttttttttCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGAtttttttttCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCT
  3   1   2       bld Ga12      in                         XL219a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCAGCAACGGTCCATTTTTGGCATATTGGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGNTAACTTTGTAATTGCTTCTACTGTGGAATTCCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAAT
  3   1   2       bld Ga12      in                         XL187f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATTAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATT
  3   1   2       bld Ga12 5g3  in                         XL191p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTNGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAA
  3   1   2       bld Ga12      in                         XL206p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCAACGTCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAAT
  3   1   2       bld Ga12      in                         XL211j18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCATTTTTGCATATTGCATATTTTCAAAAAAAGTTGTAAATACTTTTTTCATTTATTTGTAAGAAGGGATGTCTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATT
  3   1   2       bld DMZ       in                         xl272l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTAAATAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTT
  3   1   2       bld Ga12                                 XL148n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCTAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAACACTCATTTTTAGAGTCTTTGATCAACGNTGAATCNTTTTGNAGG
  3   1   2       bld Ga12      in                         XL147k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTGCTAACTTTGTAATTGCTCTACTGTGGAATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCT
  3   1   2       bld Ga12 5g3  in                         XL168f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCTATGAAAACCAGGGATTTTTTTATTTTATTCCGCAAGCATTTTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTC
  3   1   2       bld Tbd7                                 XL060g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAAACCAGGGATTTTTTTTTTCTTATTCCGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAAT
  3   1   2       bld Tbd7                                 XL092i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCCTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCANCAATAACTTTTTTTGTGCCTTTNCCTGCACTTGTAATGC
  3   1   2       bld Ga12 5g3  in                         XL175g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATNTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCNGCAATAACTTTTTTTTTGTCCTTTCCTC
  3   1   2       bld Ov1       in                    IMAGE:5074710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12 5g3  in                         XL175d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGCTCTGTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGANATTTTATCATCTAAAAGAAATAAAAAGCGCAAAACTTTTTTTTTGTCC
  3   1   2       bld Ga12      in                         XL190p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCCTATTGCACTGACGTGTAGAGTTCCAGTTACTCAGTAGTTAAAAAATCTTACTCGGTTTTAATTGAATGCAAGTGATTTTTTTTTCTTTACTATAAAATAATGTGCTTAAAAGCCTTACTGAATCAATATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAATAAATTATCAACACTTTATTAATGTGCTTATTCTTTGAGACCTTTCCCAAAGCTTTTTGATTTTGATAGACACAGTCCTTTTTGCTTTCATTTATGAGGAGAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAGAGGCTGAAGCCAGTTGTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTA
  3   1   2       bld Oo1       in                    IMAGE:3404484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGCAGTCTTTTCAAATGCATTTTTTACTCTCCTTAAGAAATGTCTTGAAATTCAAAGGCTTAAGCCAGTTGTTAAAAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAAAAATAAAAAGCTGCAATAACTTTTTTTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAACAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTTTACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAACAAGAA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402159.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAACA
  3   1   2       bld Sp1       in                    IMAGE:4173247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAAGAAATAAAAAGCTGCAATAACTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAACAAGA
  3   1   2       bld Sp1                             IMAGE:4174627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAAGAAATGGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGTGCCCTGTAAAGGAAAACCTCCAACGATATTTTATCATCTAAAACAAATAAAAAGCTGCAATAACTTTTTTTTTTTTGTCCTTTCCTCACTTGTAATGTACATTATTCTTAAATAAAATTGACTGTAAACAAGAA
  5   1   2       bld Ov1                             IMAGE:6317047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATACTCGTTTTTAGAGTCTTTGATCAAACTGAATCTTTTTGTAGGTGTTCTGTAAAGGAAAACCTCCAACAATATTTTATCATCTaaaaagaaaaaaaaaGCTTAAATAACTTCTTCTTTTCCTCACTTCTAATGTACATTATTCTTAAATAAAATTAACTGTAAACATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)