Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl324i21.3                           12 END     6           7       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl324i21.3                           12 PI      84       1266     1820                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012769059 Xl3.1-XL513j14ex.3 - 76 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL513j14ex.3                          CGTGAGCGCGCTTCCTGGACCCGCCTCCTGCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCAGAGAAAGAGGTAAAAAAGGAAAAGGAGAAAGATAAAGGAAAGACCGATAGTGGAAAGGAAGATGAGAAAAAGAGCAAGAAAGATCCTCCCAAAGAGGAGAAATCAAAAAAGGAAAAGAAAAAAGAACCTGAAAAAGAGGAAGTAAAGAAGGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGTCATTTCAAGAAGCTTTGAGTGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCATATATCTATCAATTATATATATATTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAATGCTTAT
                                                  Xl3.1-CHK-1012685917                                CGCGCTTCCTGGxxCxxxxxxxxxCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCAGAGAAAGAGGTAAAAAAGGAAAAGGAGAAAGATAAAGGAAAGACCGATAGTGGAAAGGAAGATGAGAAAAAGAGCAAGAAAGATCCTCCCAAAGAGGAGAAATCAAAAAAGGAAAAGAAAAAAGAAACTGAAAAAGAGGAAGTAAAGAAGGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGTCATTTCAAGAAGCTTTGAGTGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCATATATCTATCAATTATATATATATTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAATGCTTATTAAAAG
                                                      consensus depths                               4     9     4    11     4    12     6    12     8    15     9    16    13    22    16    23    16    23    17    23    17    23    17    23    17    23    17    23    17    23    17    23    18    24    18    24    19    24    18    25    17    26    21    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    23    26    24    25    22    25    22    25    23    25    21    23    21    23    21    23    19    20    19    20    16    22    15    24    22    24    16    24    21    23    21    23    22    23    21    23    18    22    19    22    18    21    18    21    18    21    15    21    16    20    16    20    17    20    16    20    14    18    14    18    15    18    14    18    14    18    13    17    13    17    13    16    13    16    13    16    13    16    13    16    13    16    14    16    14    16    14    16    13    16    12    16    12    16    11    15    13    17    13    16    13    15    12    14    13    14    12    14    11    13    10    12     9    11     9    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     8     7     8     7     8     8     8     8     8     8     9     7     8     7     8     5     6     5     7     5     7     6     7     5     6     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     7     3     8     4     8     5     8     6     9     6     9     6     9     5     8     5     8     6     9     6     9     6     9     7     9     7     9     6     9     7    10     7    10     7    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     8     6     9     7     9     7     9     7     9     7     9     6     9     6     9     6     9     6     9     6     9     6    10     7     9     7     9     7    11     7    11     6    10     6    10     7    11     8    11     8    11     8    12     8    12     8    12     8    12     9    12     9    12     9    13     9    13    12    15    12    15    13    17    15    19    16    19    16    19    17    19    16    20    17    21    18    22    19    22    20    23    19    22    20    22    20    22    20    21    21    22    21    21    22    22    23    23    23    23    23    23    24    24    23    23    23    23    23    23    23    23    23    23    21    21    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    20    20    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    17    20    16    20    15    19    14    18     6    11     5     9     4     7
                                                                   VAR                                      GGAGGAGACACAAGAAGCGGATCC
                                                                   VAR                                                                          AGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGA
                                                                   SNP                                                                                                                          A-----A-----
                                                                   SNP                                                                                                                                      ------A-----
                                                                   SNP                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                          ------C--C--
                                                                   SNP                                                                                                                                                                                                                                                  ---C------A-
                                                                   SNP                                                                                                                                                                                                                                                              ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                          ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                  ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                          G--------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                              ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                          ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                      ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                  ---C-----G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                  T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                               BLH ATG      58     835                          
                                               BLH MIN      55     263                          
                                               EST CLI      45       7                          
  5   1   2       bld Ga18      in                      xlk125l15ex.5p AGTTCTAGATCGCGAGCGGCCTGNTCGTGAGCGCGCTTCCTGGACCCGCCTCCTGCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCAGAGAAAGAGGTaaaaaaaaaa
  5  -1   2       bld Bla2                            IMAGE:7299915.5p              CCCCGGCCTGCTCGTGACCGCGCTTCCTGGACCCGCCTCTTGCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCTAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaagataaaggaaagaccgatagtggaaaggaagagagaaaaagagcaagaaagagctcccaaagaggagaatcaaaaaaaaaaaaaCTCGAGGGGGCCCGTCCCATCGCCTAAATG
  5   1   2       bld Emb1 5g                         IMAGE:6864297.5p               GGACGCGTGGGCGTGAGCGCGCTTCCTGGACCCGCCTCCTGCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACtgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcgaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaaCTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTGTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGGGGCCTGCTGAGATGCTTGTTGGGGTTTACTACCTCACTGTTTGGAGCCGGGATGTTTTGTCGCCCGGAATCCTTGGTGAGGACCTCTAATGCTGAGGAATCTCGTCGCATACAGTGTCGTCTCCGTTCCATAGCACTCAAAGACTAGAGCTACCTGTATCCAA
  5   1   2       bld DMZ       out                        xl324i21.5p                  CGGAATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATgaagacaaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaggatgaaaCTCCTGGAACTCCAAAGAAAAAGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAACATTTGCCATGGGCCTCATTCT
  5   1   2       bld DMZ       out                        xl244d23.5p                  CGGAATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCNGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATgaagacaaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaggatgaaaCTCCTGGAACTCCAAAGAAAAAGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGGGCCTCATTCTTGTTATTGCAGTAATAGCTGCGACCCTTTTTCCTTTGTGGCC
  5   1   2       bld DMZ       out                        xl248g06.5p                  CGGAATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATgaagacaaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaggatgaaaCTCCTGGAACTCCAAAGAAAAAGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGGGCCTCATTCTTGTTATTGCAGTAATAGCTGCGACCCTTTTTCCTTTGTGGCCGGCTGAG
  3   1   2       bld Ga18      in                      xlk125l15ex.3p                     CTGCTCGTGAGCGCGCTTCCTGGACCCNCCTCCTGCCACGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATNNCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTNTCCNCCGAGCACNNAAAGT
  5   1   2       chi Ga18      in                      xlk166e06ex.5p                       ATAGACATGGCGGAACGGAGGAGANACAAGAAGCGGATCCAGGAccgctcctattcatgttccagtctcgtattcaaatcaatgcatggttAATAAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk166e06ex.3p                        ATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGACCGCTCCTATTCATGTTCCAGTCTCGTATTCAAATCAATGCATGGTTAATAAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGNCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCAGAGAAAGAGGTAAAAAAGGAAAAGGAGAAAGATAAAGGAAAGnCCGATAGnnGAAAGGAAGAnGAGAAAAANG
  5   1   2       bld Ov1       out                   IMAGE:5074556.5p                                 GACCCACGCGTCCGCGCCCCCTGCCACGTCACCAGACAGGCCGGAATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATGAAGACAAAGCCcgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaggATGAAACTCCTGGAACTCCAAAGAAAAAGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGT
  5   1   2       bld Ga10      in                    IMAGE:3558180.5p                                  CCGGTTCCTGGACCCGCCTCCTGTTCGTCACCAGACAGGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacccgaaaaagaggaagtaaagaagGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTNCTT
  5   1   2       bld Oo1  5g                         IMAGE:6639828.5p                                       CGGCTGGTACCGGCCGGAATCCCGGGATCAGAAGGCCGGAATAGAATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCtgaaagtgatgaagacgaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaagatgaaaCTCCTGGAACGCCAAAGAAAAAGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATNGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGGGCCTCATTCTTGTTATTGCAGTAATCGCTGCGACCCTTTTTCCTTTGTGGCCGGCTGAGATGGCGCGTCGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGGACTGGAGGAAGGCATCACTTNCTGGTTCCTGCCTAACTTGACAGGCAGACGTTGGGTTTCATTGATTCCNTCCCCGACAGTTNATACACACGAATACCAAGGGACCNAAACCNTGACCCAGAANCAAAGAAAGAAAAGTCTGGAAGAAGAAAAA
  5   1   2       bld Neu7 5g3  in                         XL012k10.5p                                                                  ACAGGCCGGGTATAGACATGGCGGAACGGAGGAGACACAAGCAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcgaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaagGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAA
  5   1   2       bld Em10 5g                         IMAGE:8318634.5p                                                                       GGCCGGGATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCactgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcgaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaaCTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTGTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGGTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAG
  5   1   2       chi Kid                             IMAGE:7011380.5p                                                                         CCGGAATAGACATGGCGTTACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGATCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCgctgaaagtgatgaagacgaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaatgaggaggtaaagaaagatgaaaCTCCTGGAACGCCAAAGAAAAAGGAGAACCAACGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAAGAAGTATAGGTGTGGATAGATGGCTAGTGAGTTTTGAAATGAGTGTGGGGAGACATGGAGGTAGTAAGAGGATAGGAAGATTTTAGGTGAGACGGTTTAGAAAGAGAGTGAGTTATGAGATGGGGAAAAAGATGAAGAGAAAGTATGTAGAGAAGTAAAAATATTGTTGTGGTAAGA
  5   1   2       bld Gas5      in                    IMAGE:3747948.5p                                                                             ATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCActgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaTAGA
  5   1   2       bld DMZ       in                         xl335n08.5p                                                                                       GCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaactcctggaacaccaaagaaaAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCNGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCT
  5   1   2       bld DMZ       in                         xl266a24.5p                                                                                       GCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaactcctggaacaccaaagaaaAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGA
  5   1   2       bld DMZ       in                         xl258k22.5p                                                                                       GCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaactcctggaacaccaaagaaaAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCA
  5   1   2       bld Emb4                            IMAGE:4680455.5p                                                                                         GGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATgaagacaaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaggatgaaactcctgggactccaaagaaaaGG
  5   1   2       bld Ga18      out                      xlk60g16ex.5p                                                                                          TCACCAGACAGGCCGGAATAGACATGGCGGAACGGAGGAGACACAAGAAGCGGATCCAGGAAGTGGCANANNNCCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGNTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGctgaaagtgatgaagacgaagcccgaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggatgaaactcctggaacgccaaagaaaaaGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGNTCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGGGNNTCATTCTTGTTATTGCAGTAATCGCTGCGACCCTTTTTCCTTTGTGGCCGGNTGAGATGCGCGNCGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGNATTCTACTTCTTGCTGTT
  5   1   2       bld Neu7                                 XL027e11.5p                                                                                           GCGGAGGAGACACAAGNAAGCGGATCCAGGAAGTGGCAGAGCCAACCAAAGATGAGAAGGCAATAGCCAAGTACCTGCGCTTCAACTGCCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTACCAAGGCGGTGGACTGTCTAATGGATTCGAAATGGGCAAAAGCCAAGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATGAAGACaaagcccgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaaaaaggatgaaactcctggaactccaaagaaaaaGGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGGGCCTCATTCTTGTTATTGCAGTAATAGCTGCGACCCTTTTTCCTTTGTGGCCGGCTGAG
  3   1   2       bld Gas5      in                    IMAGE:3747948.3p                                                                                                         AAGAAGCGGATCCAGGAGGTGGGCGAGCCAACCAATGATGAGAAGGCAATAGCCAAGTACTTGCGCTTCAATTGTCCTTCCAAATCAACTAATATGATGGGCCACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACTGAAAGTGATGAAGACAAAGCCAGAGAAAGAGGTAAAAAAGGAAAAGGAGAAAGATAAAGGAAAGACCGATAGTGGAAAGGAAGATGAGAAAAAGAGCAAGAAAGATCCTCCCAAAGAGGAGAAATCAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL430c02ex.5p                                                                                                                                                                                                               CACAGAGTTGACTACTTCATTGCTTCCAAGGCGGTGGATTGTCTTTTGGATTCAAAATGGGCTAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCACtgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaggatgaaaCTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCANATGTTGGTTTCATTGATTCCTTCCGACCANTTTATACNCNCNAATACNAA
  5   1   2       bld Ga18      out                     xlk165o08ex.5p                                                                                                                                                                                                                                                             AATGATTCGAAATGGGCAANAGNNNGAAAGGAGAAGAAGCTCTCTTTACTAATAGAGAGTCGGTGGTTGAATTCTGCAATAGACTTCTGAAGAAACAGTTTTTCCATCGAGCGCTGAAAGTGATGAAGACGAAGCCcgaaaaggaggtgaaaaaggaaaaggagaaagaaaaaggaaagactgatagtggaaaggaagatgagaaaaagagcaagaaagatcctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaaactgaaaaggaggaggtaaagaaagatgaaactcctggaacgccaaagaaaaagGAGACCAAGCGCAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTAGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCCATGNNNNCATTCTTGTTATTGCAGTAATCGCTGCGACCCTTTTTCCTTTGTGGCCGGCTGAGATGCGCGTCGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGGTATGTATTTTCGAACGTGAAATCTTCAGAATGACACATTACCATTAAaggagaaggaaagctaccgaagcagnttattgtaaatagattagncacaatagtacaagctataacactatatttattctgcagaatnnttttactatacctgagtaaaccactctagaagctgtctctgtttgtttaggatagcagctnnnatataagct
  5   1   2       bld Emb4                            IMAGE:5572080.5p                                                                                                                                                                                                                                                                       GAAATCCAAAGCCAAGAAAGGAGAAGAAGCTCTTTTTACTAATAGAGAGTCAGTAGTTGAGTTCTGCAATAGACTTTTGAAGAAACAGTTTTTCCACCGAGCactgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacccgaaaaagaggaagtaaagaaggatgaaaCTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACCAAGGGACCAAAACCTGCCCCGAATAAAAAAGGAAACCGGGTGAATAGGAAAAACCCCCTTAGAGCGGAACCggggggggATAAATCCGAACCGCGGAAAAGAAAAGACACAACGGGGATCGCAAAGGCTTGAAAGCCGCCGTGAAGGGGAACCGGGGGGGCCAGAAGGCTCCCTGGTGGCGACAACACGCGCGTATTCTTAACTTCATGAACCACTCCCACCCGGGCGNGTAAGATAAATGAAACGGCTGTCCCCCGGCGCGATATGTATCGCGCGCGCCG
  5   1   2       bld Ga12      in                         XL211i11.5p                                                                                                                                                                                                                                                                                                                                                                 GCGAGCactgaaagtgatgaagacaaagccagagaaagaggtaaaaaaggaaaaggagaaagataaagataaaggaaagaccgatagtggaaaggaagatgagaaaaagagcaagaaagatgctcccaaagaggagaaatcaaaaaaggaaaagaaaaaagaacctgaaaaagaggaagtaaagaaGGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACNAAGGACCAAAACCTGACCA
  5   1   2       chi Ga12      in                         XL177a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGGTGAAAGGGGATTCTTTTGGTCCGGACAGACTGAAATAGTAGCTGATATTATTCTGCATCTGTGCAGAAAGTAAATGAAACCTAATGAGAATAtttttttttATGAAATCAAAACCACCCAAACACAGTTGCTTATCTTTTCCATATCGTGTAATAAATTGCTTTCTTGTTACAGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGTGAAAAGAAAGAAGAAGAGG
  5   1   2       bld Tbd7      in                         XL053d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTGAAAAGNAGAAGTAAAGTAAGGATGAAACTCCTGGAACACCAAAGAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAA
  5   1   2       bld Tbd7      in                         XL076c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTAAAGNAAGGATGAAACTCCTGGAACACCAAANAAAAAGGAGACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGG
  5   1   2       bld Tbd7                                 XL076c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAGNAAGGATGAAACTCCTGGNAACACCAAANAAAAAGGAGNACCAAGCGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAG
  5   1   2       bld Tbd7      in                         XL079f23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAAAGTTTAAGCTAGAACCACATGAGGATCAGGTTTTCCTTGATGGAAATGAGGTATATGTGTGGATATATGACCCAGTCCATTTTAAAACATTTGCTATGGGCCTCATCCTTGTTATTGCAGTTATAGCTGCGACCCTCTTTCCTCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAG
  3   1   2       bld Ga15      in                       XL430c02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTGTGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTACGA
  3   1   2       bld Ga10      in                    IMAGE:3558180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCTGCTGAGATGCGTGTTGGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAAGATGAGAAAAAGAGCAAGAAAGATGCTCCCAAAGAGGAGAAATCAAAAAAGGAAAAGAAAAAAGAACCCGAAA
  5   1   2       bld FaB       in                    IMAGE:8069850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGTTTACTACCTCAGTGTTGGAGCAGGATGTTTTGTCGCCAGTATTCTACTTCTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAA
  3   1   2       bld Ga18      in                        xlk2g01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TNTTGCTGTTGCAAGGTGCATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGCCAAACCTGCCAGAAGAAAGAGGAAACGTNTGAAGAGAAAANCCAC
  5   1   2       bld Ga18      in                        xlk2g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTGCTGTTNNNNGTGNATTCTCTTCCTTATCATTTGGCTCTTGACTGGAGGAAGACATCACTTCTGGTTCCTGCCTAACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL211i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTTGACAGCAGATGTTGGTTTCATTGATTCCTTCCGACCAGTTTATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAAT
  5   1   2       bld DMZ       in                         xl287n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATACACACGAATACAAAGGACCAAAACCTGACCAGAAGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTG
  5   1   2       bld Ov1       in                    IMAGE:5074228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCCACGCGTCCGCGTGTGAAGAGAAAAAGCCACTAAAAGTAGACCGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAA
  5   1   2       bld Brn1                            IMAGE:4740182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAGAGGAAACGTGTGAAGAGAAAAAGCCACTAAAAGCAGACAGTGAGGATAAATCAGACAGCGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGGCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGC
  5   1   2       bld Emb4                            IMAGE:5570952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGATAAATCAGACAGTGAAAAGAAAGAAGAAGAGGACAGAAAGGCTGAAGCAGCGGAGGGATCAGGGAGCGAAGTCTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGAACCTGTGTGGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGNCTTGTTAGGTGCACCCCATATAAGATGGTCTGGGTCATTTTCAGAAAGCTTTTGAATGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTACCTCTATGAAGAAAATGTTTTTAAATCCGTGGGATAACTGCCTGGGGAATTTGTATTACAACCAGCAGTTCAGCAATTGGCAttttttccaccaaccccccgctaaaactttttccccccacaaagggtgggccccccTTGGCCGGAAAAATTTT
  5   1   2       bld Ga18      in                       xlk57j13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAAGAAGAAGAGNNNAGAAAGGCTGAAGNAGCGGAGGGATCAGGGAGCGAAGNTCTGGTGCAGAAAGGCAGTCAGACACAGATAGTGACAGGCGGGAAGATGAAGGCTCACAGCATAGTAGTGGCAATGGAAATGATTTTGAAATGATCACAAAGGAGGAACTTGAGCAGCAAACTGATGAAGGAGACTGCGAGGAGGAGGAAGAGAATGTTAAAGAGGAAGAAGGCACAGTTGAGAGTAGGCCTCTATGTGGAAAATCTTAAGACTTGGCTGGTGTTTGTGACTGATTATATGCTTGGATGGATATTTCCTTAGAGTGATCACCAAACATCACATAGTTTCCTTCACTCTTCTTTACGATATGCAGATTCTGTAGGGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGNCATTTCAAGAAGCTTTGAGTGTAANATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCNNG
  5   1   2       bld Oo1                             IMAGE:6638821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATCATAAAATATGTTAAGTTAATTTCCAGAAAATAATTTTTATNTGGAGGAAAATCAAATCCTTTTTCAGTGAAACAAAATGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGTCATTTCAAGAAGCTTTGAGTGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATAACTAGGTTACGTACAGTTCatatatctatcaattatatatatatttagtgaagaaattttattttataAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTANAAGTACGGCATAGTTTTTGATGGTATTTTTGGTACTACCATCCCCATTTGAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCCAGCACCCAGTTCCCCTAANTATGTAGTGATAAATAATAATGAAATGGTCTTTTTGCCCTAAAAAATCACCTTCCCACCCTCCCTATGGGTTGGTTTTTAAAAGTGGCTC
  5   1   2       bld Neu7                                 XL001d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCTTTTTCAGTGAAACAAAAGCAAGTCGTGACAGTACGTGCTGGCCTTTAACCTTCACTTGTTCTATCACGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGTCATTTCAAGAAGCTTTGAGTGTAACATCAGCATCCAGATGTAGCATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGG
  5   1   2       bld Tbd7                                 XL054k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAACCTTNCTTGTTCTATNCGTTCCTGTGTAGCAGAATGTGATCCATGTGTAATATTGCAACTGTTGGGGTTCAGCTATCTGCATGCAGCACACACTTATTGCTGCTTGTTAGGTGCACCCCATATAGATGGTCTGGTCATTTCAAGAAGCTTTGAGTGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACATTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAacacacacacacacaGTAAGCCCCT
  3   1   2       bld Ga18      in                       xlk57j13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGNTCATTNNAGNAGNTTGANNNNACNNCAGCATCNAGNTGTAGCNNNTANTTNATGNAAAATTAACTCTATGNAGAAATGTTTTAAATCNGNGGANAAGTGCTGGGAGTTGTAATAAACAGCAGTCANNATTGCATCTTTCANNANNCCCCACTAGNCTTTTNCACCAGTAAGGCTGGCACNCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCATATATCTATCAATTATATATATATTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTTATTCCTGATCATAAATAGCACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAG
  5   1   2       bld Brn1                            IMAGE:6951827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGGACCGGTCCGGATTCCCGGGATCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAacacacacacacacaGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACCTAATGCCTAGGTAGATAAAGAGACGGAGGTGAAAATTTACTTGGTTTTTAATTACCTCAGCCGCACCCTTTTAAGGGGCATAAGGTGTACAAttttttttGGGTCCCGGCCCAGAAAATAATTAGTTTTAACCAAAATATAAATATATCCCCAAAGTTTTTATTTT
  5   1   2       bld Emb1                            IMAGE:6633625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGGTAACATCAGCATCCAGATGTAGCATAATAATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATGAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCGTCTATCGGTTAACGTTTGATCAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTTATTCCTGATCATAAATAGCACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAAATACTTTGTTTTTATTACTCAGCGCACCCTTTATGGCATAGTGGTACAtttttttttGGTCCTGCCAGAAATATANGTTTACAAATAAAATATCCCCAGNTTAATTTTCGTCTGG
  5   1   2       bld Ga15      in                       XL513j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTTATGCAAAATTAACTCTATGAAGAAATGTTTTAAATCCGTGGATAAGTGCTGGGAGTTGTAATAAAACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCGTCTATCGGTTAACGTTTGATCAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAACACACACACAGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTTATTCCTGATCATAAATAGCACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGT
  5   1   2       bld Egg1                               PBX0038A10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGACAGCAGTCAGCATTGCATCTTTCAGCAACCCCCACTAGACTTTTCCACCAGTAAGGCTGGCACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTCTATTGTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAacacacacacacacaGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTACTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATCGAATGTCACCTGATGGGCCAAGATTTGAA
  5   1   2       bld Egg2                            IMAGE:5162094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCCCTGTCGGAGAATTCCCGCATCATTTAGAGCCAAATAAGAATGAATCTGATCTATACCGTTAAGTCCTTATAGTGTTTGATTCTGCTGATCACTAGGTTACGTACAGTTCatatatctatcaattatatatatatTTAGTGAAGAAATTTTATTTTATAAAAACTTTAATGACATCCCTTCTATCGGTTAACGTTTGAACAGAGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGGACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAacacacacacacacaGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATAT
  5   1   2       bld Egg1                               PBX0044D02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGAGGCGCGTTAGTCGGTTGCAGCGCTGTAAAAGTACGGCATAGTTTTTGATGGTATTTTGGTACTACCATCCCCATTTTAAACTCTTTAGTGTAAACTGAATAAAATGAacacacacacacacaGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACAttttttttGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCT
  5   1   2       bld Egg1                               PBX0094F12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCACGAGGGTAAGCCCCTATACCGAGAATTCTTGAGGTTGATTCCCAGCACCAGTTCCCTATATGTAGTGATAAATATAATGAATGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACAttttttttGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTG
  5   1   2       bld Egg1                               PBX0140F11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGTTGAGTTGATTCCCAGCACCAGTTCCCTATATGTGTGATAATTAATGAATGTCTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTTATTCCTGATCATAAATAGCACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACAttttttttGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAACTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCT
  5   1   2       bld Brn1                            IMAGE:6955790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGCTTGGTANNCCGGTCCGGAATTCTCCGGGATGATAAATATNAATGAATGGTCTTTTGCCTAAAAATCACCTCCACCTCCTATGGTTGTTTTAAAGTGCTCCTTCTGCATCTAATTCCTGATCATAAATAACACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACAttttttttGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACGATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGGATAATTCACCTTCTAAGATGATTAATGCCCTGCAGGACACTGTTCCCATTGAATGGCTCCATTTTCTATCAGAACTTTTGAATAGAAGGTAATTACAGTTCTTTTAGTCCTaaaaaaaaCCCCTGGGTTGGTATACGGGGGAGTCCTTTCTTGTGGGATGGTAGTTTGTTTTCCAGGCTTTCAGTTTTGGTGCCCACCATTTCC
  3   1   2       chi Brn1                            IMAGE:6950633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCTCCCTAAGGGGTTGTTTTTAAAAGGGGCTTCCTTTTGGGCATTTAAATTTCCCCGGATTCATTAAAATAACCCCCCGGATTTAGTATAAGGTAGGCTGGTTAATTTGGAAAAATTGAAATGTCCACCTGATGGGCCAAAGATTTGAAGGAAAAGATGGTGGGTTAAGAGGGCATATTAATGCATAGTAGATAAGGGACCGAAGTGAAAATTACTGGTTTTTATTACTTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCAGNACGCATGTTGGAAAAATCNNGGGTGTGGCGGGGGGGCGTGACTCGGGGATGAGTGTATTAAATCATNGTATCTGTC
  3   1   2       bld Tad1      ?                     IMAGE:6878475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATGCTGGTTTAAAAGTGCTCTTTTGGCATTTTATTCCTGATCATAAATAGCACCAGATTAGTATATGTAGCTGTTATTTGTATAATTGGAATGTCACTGATGGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCATTA
  3   1   2       bld Ga15      in                       XL513j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTGCATCTTATTCCTGATCATAAATAGCACCCAGATTAGTATATGTAGCTGTTATTTGTATAATTGAATGTCACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCA
  3   1   2       bld FaB       in                    IMAGE:8069850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATAGTAGCTGTATTGTATATTGATGTCACTGATGGGCAAGATTGAGAAAAGATGGTGGTAAGAGCATACTAATGCATAGTAGTAAGAGACGAAGTGAAATTACTTGTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGAGTCTTTCTGTGGGATGTAGTTTTTCCAGGCTTCAGNCAGGCCAACAAACAACNAGAAGAANATAGACTGATATTAA
  3   1   2      seed DMZ       in                         xl287n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAAC
  3   1   2       bld DMZ       in                         xl258k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGATGGGCCAAGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAATCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATG
  3   1   2       bld DMZ       in                         xl266a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANGATTTGAAGAAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAATCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTC
  3   1   2       bld DMZ       in                         xl335n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAAAAGATGGTGGCTAAGAGGCCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAATCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCAT
  3   1   2       bld Neu7 5g3  in                         XL012k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAGATGGTGGCTAAGAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATG
  3   1   2       bld Neu7                                 XL036l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATATCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAAG
  3   1   2       bld Neu7                                 XL017m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATACTAATGCATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATA
  5   1   2       bld Tad2                            IMAGE:6875443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGTAGATAAGAGACGAAGTGAAAATTACTTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACAttttttttGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGGATGTAGTTGTTTCCCAGGCTTCAGTTTTGTGGCAACATTCCCATGTATGGTAAGTATAAAATAAAACCATGGCTTAATTAAAAGTAAAAGGTGGACAGAATTTTTTN
  3   1   2       bld Tbd7      in                         XL053d10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTTTTTATTACTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGT
  3   1   2       bld Tbd7      in                         XL076c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGCGCACCTTTATGGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTNCTTTNCTGTGGGATGTAGTTGTTTNCCAGGCTTCAGTTTTGTGCCAACATTNCCATGTATGTAAGTATAAATAAAACAATGCT
  3   1   2       bld Ga12      in                         XL177a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATAGTGTACATTTTTTTTGTCCTGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATG
  3   1   2       bld Tbd7      in                         XL079f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGAAATATAGTTTACAAATAAATATCCAAGTTATTTCGTCTGACTTGAAATGGATATACTGGTGGTCATTGCGAAAGTATGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAA
  3   1   2       bld Ov1       in                    IMAGE:5074228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGTGGTCATTGCGAAAGTGTGTTGAATTAGAGGAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAATCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAAGGCTTAATAAAAGTA
  3   1   2       bld Li1                             IMAGE:3398636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAAAGTATGTTGAATTAGAGNAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAAGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAATGCTTATTAAAAGTAAAA
  5   1   2       bld Egg1                               PBX0097D04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAATATTGAACCTGGCACGTGTTTATAGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACTTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAATGCTTATTTAAAA
  3   1   2       bld Oo1                             IMAGE:3405478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAAATGTTTATATATACTTATATGAGCTCTAGGCCCCAGTTAGATACAGAGGCTTATATATCCCTAGGAATCGGGGAACTTGGGAAGCTGCTAGAACCTTACCATTGCCTTAGCATAAGCAAACGAAATCCAAATGATAATAGATCAGTGTTCAATGTTGAGGTGCAAATACCCTCAGTTCTGTGAGTACACAGCAAGACTGTAAAGGAAAGAGTTGGAGCTGTAGTTCTGTGGAGACGGGTTCCCTCTATAGACAAATGTAACTGTTTTCTAAATTATTTACGTATTTTAATTGTATAATTCACCTTCTAAGATGATTAATGCCTGCAGGACACTGTCCCATTGAATGCTTCAATTTCTATCAGAACCTTGAATAGAGGTTATTACAGGTCTTTAGTCATAAGAAAGCCCTGGGTTGTATACGGGGAGTCTTTCTGTGGGATGTAGTTGTTTCCAGGCTTCAGTTTTGTGCCAACATTCCATGTATGTAAGTATAAATAAAACAATGCTTATTAAAAGTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)