Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL492f12ex.5                         38 END     1           3        2                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012769064 Xl3.1-XL470j16ex.5 - 32 ESTs
                                                                       -120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL470j16ex.5                                                                                                                         TGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTTTTAAAGCGTTTTTTGGGGAAAAAGTAAAATTTGTTTAAACAGTCTAAAA
                                                  Xl3.1-CHK-1012687898                                                                                                                               CTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTTTTAAAGCGTTTTTTGGGGAAAAAGTAAAATTTGTTTAAACAGTCTAAAAAAAAAA
                                                      consensus depths                                                                                                                             12    19    13    24    23    25    23    25    23    25    25    26    25    27    25    27    27    29    27    29    27    29    27    29    26    29    27    29    27    29    27    29    27    29    27    29    27    29    29    29    29    29    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    22    32    23    32    25    32    25    32    25    32    25    32    25    32    24    31    24    31    21    31    23    31    23    31    21    31    17    31    18    31    17    30    12    19     9    17     7    17     4    11
                                               BLH ATG      78     354                                                                                                                         
                                               BLH MIN      78      63                                                                                                                         
                                               BLH OVR      78      78                                                                                                                         
                                               CDS MIN      78      62                                                                                                                         
                                               EST CLI      -4      62                                                                                                                         
                                               ORF LNG      78       2                                                                                                                         
  3   1   2       chi Ga18                             rxlk115i17ex.3p ANTTTCCATNAAGCTGANNNCTAGCNACTANATAGTTNCTGAAATGCAAAACTAGAAAGCTGCTGAACTCAAATCTACAAAATTAAAAATGAAGGCCAGCTGCAAATTGTCTCAGAATNTCCCTGTCTTCTTTTTATTAAAACTTTTAACTAGCCGGCAAGGTGCCTGGTTGCTAGGATAAGATGAACACTAGCAATATAAGCAATATTACAATATTCACAGTAAGCCTAATAGATGACAATAGCAATTCTAGCTGCCATGTGAACAAGTAGTGAGTATTGTCTTGAAAATGTAACTATGCATTCATTAAATGCCATTTCTAATACAACAGTTTTGTCCTCCACAGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANNCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTNCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGANCCNTCTTTTTTAACAAAGNTCTATTTNTTTTNNAAA
  3   1   2       bld Skin 5g3  in                    IMAGE:8641506.3p                                     ACATTTGCTGGGAGTGGAGCAGCTGATTAGGGACATATAGATACAGCTACTGTTCTTTGCAGATCCCATCGATCGAATGTCCCGACTGGTATCTTATAGAACGTAGTGGTACCGGCGACTACAAGTAATTACCAAGTTCTGCTGGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTAACAAAGATCTATTATTTTTAAAGCGTTTGGGAAAAGGAACTTTCGNTTTTTAAGAAGTATAATT
  3   1   2       bld Ga18 5g3  in                       xlk70h24ex.3p                                                                                                          CCACGCGTCCGGACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGNANNTCTNCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTNCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCNNNNNTGTGAGCCATCTTTTTTAACAAAGNTCTATTTATTTTTTAAA
  5   1   2       bld Ga15 5g3  in                       XL470j16ex.5p                                                                                                                  GAGGACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCttttttaacaaagatctatttattttttaaagcgttttttggggaaaaagtaaaatttgtttaaaCAGTCTAANAA
  3   1   2       bld Ga18 5g3  in                        xlk2n20ex.3p                                                                                                                  GAGGNCTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTNCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGANCCNTCTTTTTTAACAAAGNTCTATTTATTTTTTAAA
  5   1   2      seed Te2N 5x3                        IMAGE:7204165.5p                                                                                                                   AGGACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCttttttaacaaagatctatttattttttaaagcgttttttggggaaaaagtaaaatttgtttaaaCAGTCN
  3   1   2       bld Ga18 5g3  in                      xlk164b04ex.3p                                                                                                                   AGGACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANNTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTTTTAAANCGTTTNTGNNAAAAA
  5   1   2       bld Ga15 5g3  in                       XL483e18ex.5p                                                                                                                     GACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCttttttaacaaagatctatttattttttaaagcgttttttggggaaaaagtaaaatttgtttaaaCAGTCTA
  3   1   2       bld Ga15 5g3  in                       XL483e18ex.3p                                                                                                                     GACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTNTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTTTAAAGCGTTTTGGGAAAA
  5   1   2       bld Skin 5g3  in                    IMAGE:8641506.5p                                                                                                                     GACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCttttttaacaagatctatttattttttaagcgttttttggggaaaagtaaatttgtttaacagccaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGGCTGAATCTTAGACGCGCTCGAGCTCTCGCTATATGATCTATACTAATCAACTGAAGATCATGTGAGTGACANCCACTGATGATGAAATGCTATGGAATGG
  3   1   2       bld Ga18 5g3  in                        xlk7m06ex.3p                                                                                                                     GNCTTGGTATCTTATAGAACGTAGTGGATNCCGGCGACTACAAGTAATTTNCCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTNCCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANNCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGANCCNTCTTTTTTAACAAAGNTCTATTTNTTTNTAAA
  3   1   2       bld Ga18 5g3  in                       xlk51d18ex.3p                                                                                                                     GACTTGGTATCTTATAGANNGTAGTGGATNCCGGCGACTACAAGTAATTTNCCAAGTTCCTGCTGNCAAAAAACTCGCAGTCATGGCAAATGGANCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGNANNNCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTNNNNTAAANC
  3   1   2       bld Ga18 5g3  in                       xlk72j02ex.3p                                                                                                                     GACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGNANNTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGNCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCATCTTTTTTAACAAAGNTCTATTTATTTTTTAAANCG
  3   1   2       bld Ga18 5g3  in                      xlk165m12ex.3p                                                                                                                      ACTTGGTATCTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGANCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGNANNTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCNNCTCTGTGANCCNTCTTTTTTAACAAAGNTCTATTTNT
  5   1   2       bld Ga18 5g3  in                       xlk51d18ex.5p                                                                                                                      GANTTGGTATCTTATAGAACGTNNNNATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGNNCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGNTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGNTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTNAATACCTTGCTCTGTGAGNCATcttttttaacanagatctatttattttttaaancgttttttGGGGNAAAGNAAAANTTGNTTNA
  5   1   2       bld Ga18 5g3  in                        xlk7m06ex.5p                                                                                                                      GANTTGGTATCTTATAGAACNTNNNNATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGNTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCttttttaacaaagatctatttattttttaaagcgttttttggggaaaaagtaaaatttgtttaaaCAGT
  5   1   2       bld Ga18 5g3  in                       xlk72j02ex.5p                                                                                                                      GANTTGGTATCTTATAGAACNTNNNNATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGNTAACCTTCTGGGATTTGccccccccATCTGCTGCTTGTGTATGTGNNAATACCTTGCTCTGTGAGCCATCttttttnacnaagatctatttattttttaaagcgttttttggggaaaagtaaaanttnntnaacagnctaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk165m12ex.5p                                                                                                                       ACTTGGTATCTTATAGAACNNNNNNATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGNCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGNCATCttttttaacaaagatctatttattttttaaagcgttttttggggaaaagtaaaatttgtttaaaC
  5   1   2       bld Ga18 5g3  in                       xlk70h24ex.5p                                                                                                                        ACTTGGTATCTTATAGAACNNNNNNTACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGNTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGNNCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGNTAACCTTCTGGGANTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGNCATCttttttaacaagatctatttattttttnaancgttttttggggaaaaagnaaanttgtttaaanagtcaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                        xlk2n20ex.5p                                                                                                                           GNTATCTTATAGAACGTNNNNNTACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGNCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTNCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGANNCatcttttttaacaaagatctatttattttttaaagcgntttttggggaaaagtaaaatttgtttaaacaaaaaaaaaa
  5   1   2       bld Ga18 5x3                          xlk124e07ex.5p                                                                                                                           GGTATCTTATAGAACNNNNNNATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGNTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGNTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGANTTGCCCCCCCATCTGCTGCTTGTGTATGTGTNAATACCTTGCTCTGTGAGNCATCttttttaacaaagatctatttattttttaaagcgttttttGGGGAAAAANNNAANTTGTTTAAACAGTCTATTTGTGCT
  5   1   2       bld Ga18 5g3  in                      xlk164b04ex.5p                                                                                                                            GGTATCTTATAGAACGNNNNNTACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGANTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGNCATCttttttaacaaagatctatttattttttaaagcgttttttggggnaaagtaaaatttgtttaaanagtcaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk112b14ex.3p                                                                                                                               CTTATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANNTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCATCTTTTTTAACAAAGNTCTATTTATTTTTTAAANC
  5   1   2       bld Egg1 5g                            PBX0134F09.5p                                                                                                                                 TATAGAACGTAGTGGATACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACC
  5   1   2       bld Ga18 5g3  in                      xlk112b14ex.5p                                                                                                                                                 TACCGGCGACTACAAGTAATTTACCAAGTTCCTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATANCTTGCTCTGTGAGNCATCNtttttaacaaaganctatttattttttaaagcgttttttggnnaaagnaaaanttgtttaancagtctaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL470j16ex.3p                                                                                                                                                                                CTGCTGGCAAAAAACTCGCAGTCATGGCAAATGGAGCCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTNTCTAGTNTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTTTTAAAG
  3   1   2       chi Tbd7                                 XL069d13.3p                                                                                                                                                                                          GAACNCTAGCAATATAAGCAATATTCAATATTCACAGTAAGCCTAATAGATGNCAATAGCAATTCTAGCTGCCATGTGAACAAGTAGTGAGTATTGTCTTGAAAATGTAACTATGCATTCATTAAATGCCATTTCTAATACAACAGTTTTGTCCTCCACAGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTNTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTAAANAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATTCCTTGCTCTGTGAGCCAAAAANTTTAACAAAGATCTATTTATTNNNTANAGCGTTTT
  3   1   2       bld Ga18      in                       xlk56k04ex.3p                                                                                                                                                                                                                    CCGCTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGNANNTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCNTCTTTTTTAACAAAGNTCTATTTNTTTTTTAAA
  5   1   2       bld Ga18      in                       xlk56k04ex.5p                                                                                                                                                                                                                       CTCCCGAAAGTCAGCAAGACACTCTACCAGAAATAGTCGCCGCTGTCAATTTCCTCTCTAGTCTTCTGCAAACTCGACTGAACGAACAACAACTGAGGGGCTTCGGAAGAACATTACGGAACACCCTAACTGAACACTACACACATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGNCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCatcttttttaacaaagatctatttattttttaaagcgntttttggggaaaaagtaaaatttgtttaaacagtctaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk126h11ex.3p                                                                                                                                                                                                                                                                                                                                                                           TTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAANNCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTNCTCTGTGAGCCATCTTTTTTAACAAAGNTCTATTTATTTTTTAAA
  5   1   2       bld Ga18      out                     xlk126j11ex.5p                                                                                                                                                                                                                                                                                                                                                                           TTGGTTTCCAGACAAGCCAGCAAAAGGNTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGNGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTNAATACCTTGCTCTGTGAGCCATCTTTTTTAACAAAGATCTATTTATTTNTTAAAGCGNTTTTTGGGGAAAAAGTAAAATTTGTTTAAACAGTCTaaaaaaaaaa
  5   1   2       bld Ga18      in                      xlk126h11ex.5p                                                                                                                                                                                                                                                                                                                                                                           TTGGTTTCCAGACAAGCCAGCAAAAGGNTCTGGGTATCGTTGTATCAGGATAAACCATAAGATGGATCCAGTCATCAGTAAAGTTGCAAGTCATATCAACTTGAGTAACCAGCATCTGCTCAGTCTATTGCCCAAAGAGCTCACACTTTGGGTGGACCCTTTTGAAGTTTCATACCGAATTGGAGAGGACGGTTCAATTTGTGTCTTGTATGAAGCCTCTGCCCCATCTACAAGGGGCCATTTGAACTGCAAAAGTGAGGTGCTGGGGAGTTCCAGCACTCCTACCCACTACCTAATGACAGTGACCAGTTAACCTTCTGGGATTTGCCCCCCCATCTGCTGCTTGTGTATGTGTAAATACCTTGCTCTGTGAGCCATCTTTTTTAACaaagatctatttattttttaaagcgttttttggggaaaaagtaaaatttgtttaaacagtctaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)