Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7393809.5                      75 PI      91         26     1442                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012769166 Xl3.1-IMAGE:6951084.5 - 45 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6951084.5                AGATTGTTTCCGAGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGAC
                                                  Xl3.1-CHK-1012686915                      TTTCCGxxxAxAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAA
                                                      consensus depths                     2     4     5     8     8    10    13    15    15    18    16    18    20    22    20    22    20    22    20    22    22    25    23    25    23    25    22    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    24    27    28    29    28    29    27    30    29    31    27    31    29    30    29    30    29    30    29    30    29    30    28    31    28    31    25    31    26    31    25    30    26    30    24    32    25    32    25    32    25    33    21    33    22    32    23    32    21    31    20    31    18    31    19    30    17    29    17    30    17    30    16    28    18    29    17    27    13    27    13    25    12    24    11    24     9    23     9    22     9    21     9    19     9    18     9    18     9    17    10    17    10    16    10    17    13    17    12    18    13    18    13    18    13    18    11    18    13    18    12    19    14    19    12    15    12    14    12    14    10    14    14    15    14    15    14    15    14    15    13    14    13    14    13    14    13    14    11    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13    12    13     9    12     9    12     9    12     9    12     8    12     9    12     9    12     9    12     9    12     9    12     9    12     8    12     6    11     7     9     4     6     3     5
                                                                   SNP                                                                                                                                        ----------G-
                                                                   SNP                                                                                                                                                    -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                               BLH ATG     101    1915                
                                               BLH MIN      80     319                
                                               BLH MPR      71     319                
                                               BLH OVR     101      20                
                                               EST CLI      13      10                
                                               ORF LNG     101       1                
  5   1   2       chi Te2N                            IMAGE:7765282.5p CCTGCTTCTCACAGATTGTTTCCGGTTAGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATTATGTGTTTTACCTCCTGAGGATCGGCCCGTTTTATATGGAAAATATCTCATCACCTGAAAATAGAAAAAGCCATAAGCTTCTAGAGTAAGGCGTAAACGGGACCGGCGGATTCTTGAAGTGTATCAAGCCTGAATGTTGCGCACAAAACTTAAATACGTTCACCTTTCCGTAACGCCCCCATCATTGATAATTAGGATAAACCTTTCCTACCCTTATTCCTTATGACCACGGCTGCTAAATACTCTTATTCAATTTGGTTCCTCGCCGCCTCATTTATTTAATTCCTCTCCCCCGCTTTATATGATGATTACTCCTTTGTACCATCTTCC
  5   1   2       add Ga18 5g3  in                      xlk147j10ex.5p    CCTNCTTCTCACAGATTGTTTCCGGTTAGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGGNNGTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGNCGGGATGTGCCGCTCCGNACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGNCCTNNNNNNCNGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGNCAGAAGNCTCATAGANGAANNNGGNNNNNGGACCGGNGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGNGGCCATCAGAGANTTCAAGCAAGNGNCCGACCTCTTCCTGGACANCGNCT
  5   1   2       chi FaBN                            IMAGE:8076904.5p       TTGACTAGAAGTTTCGGTCGGTTCCGGGTGCGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCTATGATGGCCAGAGCCTATTATATGTGCAGAATCGGCAACAGCGATGGGGCCTTCACTGTCTTTCGGAAGATTATATAAAGACGGTGGCCCTTGGGAATCGTTTGTATATTAAGTTTTACCTTTGTAGATAGGTCGGTCATATAGAAATACTTCTTCCACCTATACATGCTGAGATTCAATACCTTATATGTATGTTGTCATAGTAAAACGAATTATTTGAAGTTTATGTCTCATCTAATGGATAATAATATATACATGAGTAAATTCACATGAATTACTTCCTAATATTAAATTGAATATGAAACTTACAATAATCAGTTACAATTTTCCCCACTA
  5   1   2       add Ga18 5g3  in                      xlk127h16ex.5p       GCTTCTCACAGATTGTTTCCGGTTAGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCNNNNNTNAAGTTCCTGCTGAGTCTCCCCGAGCACCGNCGGGATGTGCCGCTCCGNACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGNCCTTNNNNNCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGNCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGNCTCATAGANGAANGCGGNNNNNGGACCNGCGGAATCGTTTGAAGGTGTATCAGGGNCTGTACTGTGTGGNCATCAGAGANTTCA
  5   1   2       bld Emb9 5g                         IMAGE:7976968.5p                        GGTTAGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTTAAGAGGTTGGACGATCATCTGGAAGATGCAGAGAACAATTTGGGGGATAGCGAAATGCGGGACGCTA
  5   1   2       bld Spl  5g                         IMAGE:8462416.5p                         GTTAGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGNCCTGTACTGTGTGGCCATCAGAGACTTCANNGCAGCGCCGACCCTCTCTGGACACGTCTCACATCACATCTATGACTGATGACTACAAACCTCGTCCTACACGTGTAGTCATAGATGCCTCGACGGCGACTCAAGAGAGTATAANGACGAGTCTGAGTGTCCAGTGCACGTCGCATTCGTCAC
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3199866.5p                          TTAGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGGATCGT
  5   1   2       bld Tbd4 5g                         IMAGE:4059000.5p                          CCGGGACAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGTGACCGGTGGAATCGCTTTGAGGTGTATCACGACACTGTCTAGTGTGCCACTAGAGACTCCAAGCAAGCGGCCGACTTTATACTGGACCCCGTT
  5   1   2       bld FaBN 5g                         IMAGE:8075667.5p                                CAGGCGGAGGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAGGTGTATCAGGCCTGTACTGTGTGGCATCAGAGACTTTCAGCAGCGGCGACCNTCTCTGACACGTCTCACATCACATCGTATGACTGATGACTACAACCTCGTCCTACACGTGTAGTCATATGATGCTCGAGGCC
  5   1   2       bld Em10 5g                         IMAGE:7983216.5p                                        GGTGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAA
  5   1   2       bld Emb9 5g                         IMAGE:7977087.5p                                          TGACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTTACACCGTGTATGTCAGTATGATTGCCCCTCGACCGGCCCAGAC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075789.5p                                           GACGTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGNACTTCAGCAGCGGCCGACCTCTTCCTGGNACACGTCTCCACATCACATCGTATGACTGATGGATACAAACCTTCGTCACTACACGTGTATGTCATATGATGCCTCGACGGCAGACTC
  5   1   2       bld Skin 5g                         IMAGE:8641394.5p                                             CNTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAATCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGTTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGATACACAGAGAAAGTCAGAAGTCTCATAGAGGAAGGCGGAGACTGTGACCGGCGGAATCGTTTGAGGTGTATCAGGGCCTGTACTGTGTGGCCATAGAGACTCCAGCAAGCGGCCGACTCTTCCTGGAACCGTCTCCCATTCCATCGTATGACTGAGGACTCAAACCTTCTTCCTACACGTGTATGTCATTGATGCTTCGACCGCCGAACTCGAAGAAGTATAAAGACAGAATCCTGAGGCTACAGTTGCCACTCGGCGTACGTC
  5   1   2       bld Em10 5g                         IMAGE:7978794.5p                                              GTACAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGA
  5   1   2      seed Tail 5g                         IMAGE:8544516.5p                                              CGTCAGTGTCCATCCCGAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACA
  5   1   2       bld Egg6 5g3  in                    IMAGE:4434444.5p                                                         TTACACTATAGAACCAGTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGCCACCGCTTGGATATGGTGTTTTACCTCCTGAGGATCGGCCTGCTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAAAAGTCTCATAAAGGAAGGCGGAGACTGGGACCCGGCGGAATCGCTTTGAAGGTGTACCCAGGGCCTG
  5   1   2       bld Egg1 5g                            PBX0083F10.5p                                                           CCCGAGCCGGTATTCTTTCTCTGGCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGTGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAAGTGAATGAAGAAAGCCAACGAGGAGGAACTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATT
  5   1   2       bld Te2N 5g                         IMAGE:7767240.5p                                                              GAGCCGGTATTCTTTCTCTGTCTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTANCAAACCTTCGTCACTTACACCGTGTATGTCAGTATGAATGCCCTCCGACGGNCAGAACTCAGAGAA
  5   1   2       bld Eye1 5g                         IMAGE:4743473.5p                                                                                   CTCCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAATCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGACCTCATCACCCGAAACACACAGAAAGCCCCAAAGTTCATA
  5   1   2       bld Em10 5g                         IMAGE:8321351.5p                                                                                     TCGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCG
  5   1   2       bld Em10 5g                         IMAGE:7980044.5p                                                                                      CGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTACCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGAACCGTCTCCACTTCCATCGTATGACTGATGGACTAAAAACTTCGTCACTACACGTGTATGTCATATGATGCCTCGACGGCAGACTCAGAAGAAGTATTAAGAGCAAATCTAGAGGCACCAGTTGCCACATCGAGATCGTCCCTGACATGCCTCTCGCTCTCATCCTGCGCGGAAGACTGAAGTGCGTGCTTCT
  5   1   2       bld Int2 5g                         IMAGE:8529544.5p                                                                                      CGCTGCTGCTGCCGCTGTCGGTGCCGAGATGCCGCTGGAGAACCTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTATGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTTGCCCTCGACGGGCAGACCTCAGAGAGAAGGTTATTAAGGAGCAGAGATCTAGAGGTGCTCACAGTTTGCCACAGTCGGCA
  5   1   2       add Egg6      in                    IMAGE:4435158.5p                                                                                                                             GAACCTGGATGACGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCATCTCAAGTTCCTGCTGATTCTCCCTGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGCGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAACAGGCTGGACGATCAGCTGGAAGATGCATAGAATAATTTGGGGGAGAGCGAAATCCTGGACGCAATGATGGCCACAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCTGAAGACTTATGATAAGACTGTGGACCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGGCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCCTAAGTCTCCTATAGGAAAGCGGAGACTGGGACCGGACGAATCGTCTGAAGGTGTATCACGGCCTGTACTGTGTG
  5   1   2       bld Ga15                               XL497h08ex.5p                                                                                                                                 CTGGATGAGGAGGGGCTGCCCAAGAACCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCANAGAGAAGGTTATTA
  5   1   2       bld Brn1                            IMAGE:6951084.5p                                                                                                                                  TGGATGAGGAGGGGCTGCCCAAGAATCCGGATCTCCGCATCGCGCAGCTCAAGTTCCTGCTGAGTCTCCCCGAGCACCGCCGGGATGTGCCGCTCCGCACTGAACTCATGGAGGCGGTGACTGTGAATAATATGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGGAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAAGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCCTCCAGTCCCTGGCTGCTGTTGGACCAGAAACTGAGAAAGGACTGGCTGTTTGGCCTCTCACTATCGCTACTACGTGAGGGAAAATGCGGATCCAGGCTTAACGTCAGCT
  5   1   2       bld Tad1      in                    IMAGE:6879442.5p                                                                                                                                                                                                                                                                     GGGGCTCCGTATTACGAGGGTCTGTGCAAACATCTGGACTGGACGGTGGACACGGAGCTGCTGAATAAAATGAAGAAAGCCAACGAGTAGGAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAANACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAAGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGGTTTGCCCACAGTCCGGGCAGTATCTGTTCTCACTGGTACCAAGTGTCGCTACTCCGTTCTTCTTTCCAGTCCCCTGGCTTGCTGTTGGAACAGGAAACTGAAGAAAGGACTGGGCTGGTTGGCCCTCTCACTTATCGCCTACCTACCTTAAAGGGGATAAATCCCGATATC
  5   1   2       bld Te2N                            IMAGE:7204316.5p                                                                                                                                                                                                                                                                                                                                                               GAGCTGAAGAGGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTGGGTGTCNGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCCGACAGCCAAGAACTGGGCAGTTACaaaaaaacgaataaaaaaGGGGCA
  5   1   2       bld Tbd7      in                         XL064o20.5p                                                                                                                                                                                                                                                                                                                                                                         GGGACGATCAGCTGGNAAGNATGCAGAGNAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGT
  5   1   2       bld Brn3                            IMAGE:8541018.5p                                                                                                                                                                                                                                                                                                                                                                         GGCTGGACGATCAGCTGGAAGATGCAGAGAAGAATTTGGGGGAGAGCGAAATCCGGGACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCNTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTTGCTCTCACTATCGCTACTACNTGAGGAAAATGCGGATTCAGGCGTACGGTCAGCTGCTCAAGTCCTACGCTCACTACAACTGGGTACTGGCCGAGGCTTTGTTTCGGATGGAGTCATTAACAGAACTCTCCGTTTATTCGCGGAGGTTCCCTCAAA
  3   1   2       bld Ga18 5g3  in                      xlk147j10ex.3p                                                                                                                                                                                                                                                                                                                                                                                              TCAGCTNNNATGCANNGANNATTNGGGNAGANCNNATCCGGGACGNATGATGNCAGANCCGAGTATTTGNGNAGNATCGNCAACANGGATGGGGCCCTCACTNCTTTCGGNAGNCTTATGANANGNCTGTGNNCTTNNNNNCGCTTGGATATTGTGTTTTACCTCCTNNGGATCGNCCTGTTCTATATGNACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAANTCTCATAGAGGAAGGCGNAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAANNAAGCGGCCGNCCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGNCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGNNNNNNGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGNCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCNCTCGNGNNTNGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTANAG
  5   1   2       bld Tbd7      in                         XL092e02.5p                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGAGCGAAATCCGGGNACGCAATGATGGCCAGAGCCGAGTATTTGTGCAGAATCGGCAACAAGGATGGGGCCCTCACTGCCTTTCGGAAGACTTATGATAAGACTGTGGCCCTTGGGCACCGCTTGGATATTGTGTTTTACCTCCTGAGGATCGGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTTCGAGTCCTAC
  3   1   2       chi Tad1      in                    IMAGE:6879442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGGCCCCTTTTTTTGTATTAGTGGGGACCTATGGAGTTTTTCATTTCCCCCGCGAAAAACACCAGGAAGAAAGCCCCAGAAATTTTCTCATTATGAGGAAAAGGCCGGGAAAACTGGGGACCCCGGGCGGAAAATCTTTTTAAAAGGGGGTTATCATGGGCCCTGTTAACGGTGGGGCCCATTCAGGGGGTTTTCAAAGGCAAGGCGGGCGAACCTTGTTTCCAGGACCCCCGTTTCCCACAATTCACCTTCGTTATGAACCTGATTGGACTACCAAAACCTTTGGGTCCACTTAACACCGGGTTATGTCAAGTATGAATGGCCCTCGACCGGCCCAGACTTCAGAGAGAAGGTTTTTAAAGGAGCAGAGTTCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTTCTCACTGTACGAGTGTCGCTACTCCGTTTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAGGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGTTGGAAGTNNACAGAGGTTTATTATATTACCATCGGTATGTCGTGGTTCGAAGAAGAAA
  5   1   2       bld Ga18      in                       xlk66p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCGCCTGTTCTATATGGACAACGATCTCATCACCCGAAACACAGAGAAAGCCAGAAGTCTCATAGAGGAAGGCGGNNNNNGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGACTTCAAGCAAGCGGCCGACCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAANAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGNNTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAANCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCNCG
  3   1   2       bld Ga18      in                       xlk66p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCGGCCTNTTCTANATGGACAACGATCTCNTCNCCGAAACACAGAGAAAGCCAGAANTCTCATAGAGGAAGGCGGAGACTGGGACCGGCGGAATCGTTTGAAGGTGTATCAGGGCCTGTACTGTGTGGCCATCAGAGNCTTCAAGCAAGCGGCCGNCCTCTTCCTGGACACCGTCTCCACATTCACATCGTATGAACTGATGGACTACAAANCCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCNNNNNGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGNCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTNCTCGNGNNTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGNTTTTACAGANCNANACATCC
  3   1   2       bld Ga18 5g3  in                      xlk127h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGNANNANANNNAAAGCNNNAANTCTCANAGANGAAGNCGGNNNACNGGNACNGNNGGAATCGTTTGAAGNTGTATCANGCCTGTACTGTGTNGCCATCAGAGNCTTCAANNAAGNGGCCGNCCTCTTCCTGGANNNCNTCTCCACATTCACATCGTATGNNCTGATGGACTACAAANNCTTCNTCACTTACACCGTGTATGTCAGTATGATNNNNCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGNNNNNNGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTNCTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGNCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGATAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTNCTCGNGNNTNGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGANCGTAA
  3   1   2       add FaBN 5g3  in                    IMAGE:8075789.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAGGACCTGTACCGTGTGGCCATCAGAGATTTCAAGCAAGAAGCAGACGTCTTACTGATCACTGTCTCCACATTCACATTGTATGAAGTGATGGACTACAGAACCTTCGTCACTTACACCGTGTACGTCAGTATGATTGCCCTCGACCGTCCAGACCTCAGAGATAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGCATCTGTTCTCACTGTACGAGTGTCGATACTCGGTATTCTTTCAGTCTCTGGTTGCTGTGGAACAGGAACCGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGATACTACGTGAGGGAGATGCGGATCCAGGAGTACGGTCAGCTGCTAGAGTCCTACCGCTCACTAACAATGGGGTACATGGCAGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAATGGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACTTGTTACTGAACCGAGTACAGAAGCTCTCCCGTGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTGGATTTCCTTTTTCTATTATTGCGGGAGAATTGGAATGAGGAGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTCCTATCTCCCTGCTGCGTGACGTGTACCAAGGCCAGTAGCTAGGGGGTNGGGGG
  5   1   2       bld Ga12      in                         XL192c20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGAGGAAGCGGNCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGC
  3   1   2       bld Ga12      in                         XL192c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCACATTCACATCGTATGAACTGATGGACTACAAANCNTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGA
  3   1   2       bld Tbd7      in                         XL092e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGATTTTACAGAACGTAAACAATCCAGCGATGCTAAAAGAAGACAAAAAATAAAAAAA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3199866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGCCTCCGACCGGCAGACCTCAGAGATAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCNGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCTCGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGAC
  3   1   2       bld Tbd7      in                         XL064o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGAGAAGGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTNTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTNTACGATTTTACAGAACGTAAACAATNCCAGCGNATGCTAAA
  3   1   2       bld Egg6      in                    IMAGE:4435158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTGAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAG
  3   1   2       bld Egg6 5g3  in                    IMAGE:4434444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTCCAGTCCCTGGTGCTGGGGACCAGGAATTAGGAAGGACTGCGTTTCCCTCCACTATCGCTACTACTGGGGGAGATGCGGATCCAGGCGTCCGGTCAGCTGCTCGAGTCCTACCCTTCACTAACACTGGGGTACATGGCCGAGGCTTTTGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGC
  5   1   2       bld Emb1                            IMAGE:5155144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACGCGTGGGCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAATCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACTTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTGAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGACaaaaaaaaaaaaaaaGG
  5   1   2       bld Emb1                            IMAGE:6632756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGACaaaaaataaaaaaaacaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)