Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL438g23ex.5                         41 END     1           1        2                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012769188 Xl3.1-IMAGE:5161858.5 - 53 ESTs
                                                                       .-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5161858.5                                          GTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686567                                                CAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAA
                                                      consensus depths                                               6     9    10    13    10    15    15    16    15    16    15    16    15    16    15    16    15    16    17    17    17    17    20    22    20    22    20    22    20    22    21    22    22    23    22    23    22    23    22    23    23    23    22    23    24    24    23    23    23    23    23    23    23    23    24    24    24    24    25    25    25    25    25    25    25    25    25    25    26    26    25    25    25    25    24    25    24    25    24    25    24    26    24    27    25    27    24    27    24    26    23    25    24    25    23    25    21    22    22    23    22    23    21    23    21    23    21    23    20    23    20    23    20    23    20    23    18    22    17    22    18    22    13    21    14    21    13    20    13    19    13    19    13    19    13    20    11    19    10    17    10    18    10    18    10    18    11    18     9    15     8    15     8    15     7    14     8    14     7    13     7    12     5    11     6    11     6    10     6    10     6    11     6    11     6    12     6    12     6    13     7    13     8    14     7    15     5    16     6    16     6    16     6    16     7    17     6    17     8    17     8    17     8    17     8    17     8    17     8    16     8    15     8    15     9    15     9    15    10    15    10    14    11    15    12    15    12    16    12    16    12    16    13    15    13    16    12    15    12    15    12    15    13    15    12    15    14    17    14    17    14    17    15    19    16    19    16    19    17    20    16    20    17    19    16    19    14    19    16    19    16    18    16    18    17    18    17    18    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    18    18    18    18    18    18    17    18    16    18    16    17    16    17    16    17    15    17    14    17    13    17    11    16    10    13     8    13     6    11     6     9     2     4
                                                                   SNP                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                              C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                               BLH ATG      44    1183                                          
                                               BLH MIN      41     372                                          
                                               BLH OVR      44     462                                          
                                               CDS MIN      44       4                                          
                                               EST CLI     -13       4                                          
                                               ORF LNG      44      65                                          
  5   1   2       bld Sp1  5g3  in                    IMAGE:4173275.5p cacgcgtccgcccacgcgtccgcccacgcgtccgcccacgcgtccggcAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGTTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTTCCCACCATCAACCCATCTACAGCATAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGCACAA
  5   1   2       bld He1  5g3  in                    IMAGE:4409109.5p                  ACTGAAGTTTAGTTGTTGCGTTGGGTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATC
  5   1   2       bld Sp1  5g                         IMAGE:5513343.5p                         CCCACGCGTCCGCCCACGCGTCCGAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCTCTCTCTGCTCTGCATGTGCTAGCCTGTGAAGANGCTGGATCCNTTCNGGTGTGTAATATCATACTGGA
  5   1   2       bld Ga12 5g3  in                         XL150f20.5p                          ACGAGGGTTGCGTTGGGTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGA
  5   1   2       bld Oo1  5g                         IMAGE:6861793.5p                                 TTGCGTTGGGTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAAGCTGGATTCCCTCCGGGTGTGTAATATCTTACGGATGGTCCACACTGGTCACTACTCTCTCAATGATGTGATAAGTGCATTACTGGTCTACAGAGTGGTCGTTAATCCACAGCAGCTGGAAAACATTTAAAAAGTGACCTGGACTTGGTGGAAGAGCCATCATACTTTCGAGCNATTGATGGCTGACAGCC
  5   1   2       bld Ov1  5g                         IMAGE:8329995.5p                                  CCCACGCGTCCGTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCC
  5   1   2       bld Emb1 5g                         IMAGE:5161858.5p                                     GTTGGGTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAAGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCTTCTCATATGGAGGGGGATAAAGGGGCATTN
  5   1   2       chi Tad2      in                    IMAGE:6875012.5p                                          GGTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGCCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCCTAGATATTATGCGGCTGGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACCTGAACCTGTCCGAGTGTGTGGACAGATCATTCCCTGGGAATTTTCCTCTTCTAATGCTTGGCTTGGAAAATTTTGGAACCTGCTCCTGGCCACCTGGAAAATGTGAATTGTCCATTGAAAGGGGGGCTTGAAATAGAACCCCTTTTTCTCCTGGATTTTGGCAATGGTTGACTAAGCCCCTTTGGGGaaaaaaaaaGGCCTGGT
  5   1   2       chi Panc 5g3  in                    IMAGE:8735218.5p                                          GTTTTGCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCACGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCCTCTTCTGCCTCTGCATTGTTGCTAGCTTGGTGAAAGAAGCTGATCCCCTCCGGGTGTTTGTAAATACATACTGATGGGTCCCACAGCCTGTTCAGCTATTCCCTTCCATATGAATGTGGATAATGCATACTTGTTCACAAGTGGCGTTAATCCACAAGACACTGGAAAGCATATAAAAAATGAC
  5   1   2       bld Sp1  5g                IMAGE:4173275-IMAGp.IMAGp                                               GCAGTTGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGGATGTGGATAAAGTGGCATTTACTGGTTTCTACAGAGGTTGGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAA
  5   1   2       bld Egg1 5g                            PBX0166D01.5p                                                  AGGTGAAGCTCAGGCTTTGTATGTGAGTGGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGCCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGT
  5   1   2       bld Ov1  5g                         IMAGE:6318656.5p                                                    TGAAGTTCAGGCTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGGTGCTAGCCTTGTGAAAGAAGCTGGATTTCCCTCCGGGTGGTGTAAATATCATTACTGGGATGGGTCCCACAGCTGGTTCAGCTATCTCTCCTCATATGGATGTGGATAAGTGGCATTTACTGGGTTCTACCGAGGTTTGTCCGTTTAAATCAACAAGCAGCTGGGAAAAGCAATTTTAAAAAAAGTGACACTGGGAAACTGGGTGGGAAAAAGGCCCAATAAATTAATCTTTTCTTGATGCCGA
  5   1   2       bld Oo1  5g                         IMAGE:6643037.5p                                                      GAAGTTCAGGCTTTGTATGTGAGTGGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGCATTCCCTCCGGGGTGTTGTAAATATCATTTACTGGAAAGGGTCCCACAGCTTGGTTCCACCTATCTCCTCTCATATGGGAGGGGGATAAAGGGGGGATTTACTGGGTTCCTAACGGAGGGTGGGTCCGTTTAAATCCAACCAAGCAGCTGGGGAAAAAAA
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3747003.5p                                                            CTTTGTATGTGAGTGCGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGCAAGGGGTGTCTCGTGTACCCTCTGGGGNCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCANAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCCATTTCCTATGCAGGGGACTGGATCTTGGACTTAAATGGCCTAGAATTTATGCCAGGTGGGGCTGGCAATGTCATGGAAAGACCAATCCAATTCATGGGAAATAATTTAACTTACCCCAGACTTGAACCT
  5   1   2      seed Int2 5g                         IMAGE:8529362.5p                                                            CAGGCTTTGTATGTGAGTGGCCATGCTCCGGTCAGTCTTAGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGC
  5   1   2       bld Brn1 5g                         IMAGE:6952623.5p                                                                          GAGTGGCCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGCCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAAGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGGCATTTACTGGTTCTACAGAGGCTGGGTCGTTNTTAATCCAACAAGCCAGCTGGGTAAAAACAAATTTAA
  5   1   2       bld Ooc2                            IMAGE:3745967.5p                                                                                                                                                  TCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGA
  5   1   2       bld Oo1                             IMAGE:3404023.5p                                                                                                                                                                     CATACCAACCCCCAACCCTAAGCCATATGTGCACTTCAACCAGCTCTTTATCAACAATGATTGGCATGATGCTGTCAGCAAGAAGACCTTCCCGACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAACCTGATGAGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCATATTGGGATCACCATGGAGGAGAATGGATGCATGTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATAGAAAGAGACAGATCTATATGGGTCACCTTGGAGACTATAGACAATGGAAAGCCATATGCAACTTTCTATGCATTGGACGTGGATCTTGTACTAGACTGCCTAATATATTATGCAGGCTGGGCTGACAAATGTAATGGAATGACGATCCCT
  5   1   2       bld FaB                             IMAGE:8071396.5p                                                                                                                                                                        ACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTG
  5   1   2       bld FaB                             IMAGE:8071421.5p                                                                                                                                                                        ACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCCCAGCTGGTTCAGCTATCTCCTCTCTATGGATGT
  5   1   2       bld Int2                            IMAGE:8527683.5p                                                                                                                                                                          CCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTACAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGCCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAGTGGCTTTACTGGTCTACAGAGGTGGTCGTTNAATCACAGCAGCTGGAAAGCATTNAAAAAGTGACCTGGACTTGTGGAGAGCCATCATACNTCTGATCGATTGATGGCGTGACAGCCACTGCCTTCTACAGGCATGTGGG
  5   1   2       bld Brn1      in                    IMAGE:6951135.5p                                                                                                                                                                           CAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAAACTTTGGTGGGAAGAGCCCAATCATTATCTTTTTCTGATGCAAATTTGGGATTGGGGCTGTGGAGCAGGCCCCACTTTGCCCCTTTTCTTAACCCAGGGC
  5   1   2       bld Int2                            IMAGE:8531006.5p                                                                                                                                                                                                                                       TGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATGTTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGCCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCATCATTATCT
  5   1   2       bld Ov1                             IMAGE:8329955.5p                                                                                                                                                                                                                                                                                                           CAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATAATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTG
  5   1   2       bld Bone                            IMAGE:8741958.5p                                                                                                                                                                                                                                                                                                                                                                     ATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAGGAGCAAGATAGGATTGTTGGGACTCCTTTGACTTCAAAACAGAGCAGACTCAGGTGGATGAGACAGTTTAATAATCTGGGGTATATAAAATCTGGAAAGGAAGGTGCCAGCTTCTCTATGGGTGTATCCTGGCGTGCGGATCCGGAGC
  5   1   2       bld Tad1                            IMAGE:6939916.5p                                                                                                                                                                                                                                                                                                                                                                                                    GGTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCTGTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTTGGGAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCNCATCATTATCTTTTCTGATGCAGATTTGGGATTGNGCTGTGGGAGCAGGCCCACTTTTGCCCTTTTTCTTTTAACCAGGGGCCAGTGCCTGCCTGTGCCTGGCTCTTTGCACCTTATGTTTCAGGGAAGGATATCCTACAAATGAATTTTTGTTTGAANAGGAGCCATATCNAAGGAAGCAAAAGAAATTAGGGAATTGGTTGGGG
  5   1   2       bld Panc                            IMAGE:8736478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAATTCTGGGGTATATAAAATTCTGGGAAAAGGAGGTGCAAGCTTCTCTTATGGGTGTATCTGCTGCTGATCGAGGCTATTTTATTCCAGCCCCCGGTTTTTG
  5   1   2       bld Lmb1                            IMAGE:8535663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGCTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCTTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATAATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAACAGAGCAAGGACTCAGGTGATGAGGACAGTTTAATAAATCTGGGGATATAAATCTGGGAAAAGAAGTGCAAGCTCTCATGGTGTATCTGCTGCGATGAGCTATTATCAGCCACGTTTTGAATGTACGACACTACATGCTAAAGAA
  5   1   2       bld Lmb1                            IMAGE:8536045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATTATGCAGGCTGGGCTGACAAATGTCACGGAAAGACGATCCCAATAGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGTATGTTGCTAGCCTTGTGAAAGAGGCTGGATTTCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAACAGAGCAAGGACTCANGTGGAGAGGACAGTTTATAAATTCTGGGTATATAAATCTGGGAAAAGAAGGGCAAGCTCTCTATGTGTATCTGCTGCTGATCAGCTATTATCAGCCACGTTTTGAATGTATGCACTGACATGCTAAAGAATTTGACTGGAGCATCTAGTTATCATGAAGGATACACACCTCTGTGTCGCCGCTGTCAGATGAACCAT
  5   1   2       bld Tad1      in                    IMAGE:6880662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAGAGGTTGGATTCCCTCCGGGTGTTGTAAATATCATTACTGGAATGGGTCCCACAGCTGGTTCAGCTATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAACAAGGACCTCANGTGGATGAAGAACAGTTTAATAAAATTCTGGGGTATATAAAAATCTGGGAAAAAGGAANGGTGCANAGCTTNCTCCTATGGTGGTAAATCCTGCNNTGCTGATCGAGGCTATTTTTATCCCAGCCCACCGTTTTTTTGGGAGATNNGTGACTGACAAGCATGACCCATTTTGCTAGAGAAGAAGATTTTTTGGACCCTGNTGATTGCAAATTTCCTAAAGTTTTAAAATCAATTTGAAANAAGGTGGATCCGACCCGGAA
  5   1   2       bld Sp1                             IMAGE:5512239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTCCTCTCATATGGATGTGGATAAAGTGGCATTTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGGTACAGGCATCANGAATANGCAGAGAGCTTGGAGAGTATGGACTTTGAGCATACACAGAAGTGAAGAATGTCATCATTA
  5   1   2       bld Tad1      in                    IMAGE:6877451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTACTGGTTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTANAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAAAACACTCATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTTCTCTCAGTCAGTAAAAAGCTGGTACTGTCTGGGATAACTGCTATGATGTTTTTTGGAGCTCAAGCCCCCCTTGGAAGGGTAACAAGGCATCAGGAATANGGCCAAAAAGCTTGGGAGAGTATGGGACTTTGAAGCCTACACCCAAAGTGGAAGGAATGTCCACCATTAAAGAATTCCCCCCGAAAGGAATTTCTTTAAAA
  5   1   2       bld Egg1                               PBX0016E09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGCTGGGAAAAGCAATTTAAAAAAAGTGACACTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAAGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACAC
  5   1   2       bld Brn3                            IMAGE:8540174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAACTTGGTGGGAAGAGCCCAATCATTATCTTTTCTGATGCAGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCCCTTTTCTTTACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACTTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTTGGGAACCCCTTTGACTTCAAAACAGAGCAAGGACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGGAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAACATCTGGGAACTGTAGGNTGGGATCTGTAGTCAGCAGTACCTTTTA
  3   1   2       bld Tad1      in                    IMAGE:6877451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCCCTTTGGGGAATTTCCAAAACGCGGGGCCCAGGGGACCCCTGAGAGGGGGAGAATGGGGGAAACCGGGTTGAAATAAAAAATTTTGTGGGGGGGGGGATTAAAGTGTGTGGGGAGAAAGAAGGAAAAGGTTGGCAAGAGGTTTTGTGGTGAGGGGTGGGAAACTCCGGGCCTGGGGGAATGGGGGGGCCTATTTTTTATGCCGGCCCCCACCGGTTTTTGGGAGGGTGGGGGAAGGGACCAAGGTGGCCCCGGGGGTTGGGGGGAGGGGGGTTTTGGGGGCCCTGGGAAGGCAAATTTGTAAAGTTTAAAATCAATTGCGAGGAGGTGGATGGACGGGAGCCAACAACTCAATGTATGGGTCTGGCAGCGGGCGGTGTTTACAAGGGACATTGATAAAGCTCACACTTTCTCTCAGGTCAGTAAGAGGCTGGTACTGTGGGGATTAACTGCTAGGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGGTTGGATTCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTACTTCCCACCATATC
  3   1   2       bld Panc 5g3  in                    IMAGE:8735218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCAGTGCTGCTGGCTGGCTCTGCGCCATTAGGTTCAGAAGATTTCATTGATGTGAAGGAGCTACAGAGCAGATAGAATTGTTGGACCCTTGACTCAACAGAGCAGACCTCAGTGATGAGACAGTTTATAAAATTCTGGGTATATAAAATCTGGGAAAAGAAGTGCAAAGCTTCTTCTATGGTGGTAATCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTGGAGATGTGACTGACAACATGACCATGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGGAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCCTATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCCCCATATCCCAGC
  3   1   2       bld Tad2      in                    IMAGE:6875012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAATTAGGGATTGTTTGGGGAACCCCCTTTGATCTTCCAAAAACAGAGCCAAGGGACCTCAGGGTGGATGAGGAAACAGTTTAATTAAAATTTCTGGGGTATATAAAATCTGGGAAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGGATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCCAGCCGCAA
  3   1   2       bld Brn1      in                    IMAGE:6951135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGTTGGGAACCCCTTTTGACTTCAAAACAGAGCAAGGACTTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGGACTTCCCACCATATCCAGCCG
  3   1   2       bld Spl                             IMAGE:8464903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTTCTTTCAGCGGTTGGTTCTATCGGGAACAGGTGGAGGCACAGCAGATGGAGTGACCCTGATAAACAGCAGACTAGGGAGAGACATTATAATTGGGTAATAATTGGAAAAGAAGGGAAGTTCTTAGGGGTATCTGTGCGATCGAGCTATTTTCCACCCACCGTTTTGAGATGTGACGACAACAGACCATTGTAGAGAAGAGATTTTGGACCTGTGATGCAATTCTAAAGTTTAATCAATGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTGTAGACTCCTAAAGCGATTT
  3   1   2       bld Te2  5x3  out                   IMAGE:7390650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGTCGAATTCAGTGTGAGGCACAGCAGATGTGTGACCTTGATCAACGGCAGCTCAGGAGAGACATTATAATTTGGTATTAATCTGGAAAGAAGTGCAAGCTCTTATGTGTATCTGTGTGATCGAGCTATTATCCAGCCACCGTTTTGGAGATGTGACTGACACATGACCATGCTAGAGAAGAGATTTTTGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGGAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCCTATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTGTAGAACCTAAAAACCGATTTC
  5   1   2       bld Te2       in                    IMAGE:7208627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCTCAGGTGGATGAGGAACAGTTTAATAAAATTCTGGGGTATATAAAATCTGGGAAAAAGGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGCGTGCTAGACATCAAGCTATTTGCCGAAATAACATCCGTTGTTG
  3   1   2       bld Te2       in                    IMAGE:7208627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATAAAATTCTGGGGTATATAAAATTCGGGAAAAAAGAAGGTGCAAAGCTTCTCTATGGTGGTAATCCTGCTGCTGATCGAGGCTATTTTATCCAGCCCACCGTTTTTGGAGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCAATTGAAGAGGTGATCGACCGAGCCAACAACTCAATGTATGGTCTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGAAGGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTCTTTACAGACTGTGACTTCCATACCATATGCCAGCCGCGAATATAGGCACTGTAGTAACTCCTAATAAAAGCCCGGAT
  3   1   2       bld Tad1      in                    IMAGE:6880662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAAAAATTTTAGAACTTGGACCAAGGCATTGGACCCTTTTGGCTTAGGGGAAAGGAGGATTTTTTTTGGGACCCTTGTTGAATGCCAAATTTTCTAAAAAGTTTTAAAATCCAAATTGAAAGAGGGTGATCGACCCGGAGGCTAACCAACTTCAAATGTATGGTTTCGGGCAAGCGGGCAGTGTTTTACAAAAGGGACATTTGATAAAAGCTCACACTTTTCTTCTCAGTCAGTAAGAGNCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATGTAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATCTCTTCTTTCTGACTTCAAACTGTGACTTCCCCACCATATACCAGCCGCAATTTTTTTGGAAGTNGNNNNCCNCCAAGCCCCAGTTTTTTTTTGTTTTTTTTTTTAAAAnTTTTTTTNNNNNNNNNNNNNNN
  3   1   2       bld Ga12 5g3  in                         XL150f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTTAAATCAATTGAANAGGTGATCGACCGAGCCAACAACTCAATGTATGGTNTGGCAGCGGCAGTGTTTACAAAGGACATTGATAAAGCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTCGTAGTAAC
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGTGATCGTCCGAGCCACCAACTCAACGTATGGTCTGGCATCGACAGTGTTTACACAGGACATTGATAAGNCTCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTATGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGGAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACCGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAATTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTA
  5   1   2       bld Ov1       in                    IMAGE:5049331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGCCCACGCGTCCGCACACTTTCTCTCAGTCAGTAAGAGCTGGTACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAA
  5   1   2       bld Tad2                            IMAGE:6931009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATGTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATCCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCCAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCCAATAAAGCCGTATATTTTCTGTTAAAAAAACCCGCATCAACAACGAACGTCACGACCAGAACCCTTGTTGGGCCCGCCTCGGGCCCCTCTGAAAAAACTTTTCTTAAACCCTTTCCGNTTTTGGGCGCGGCCGGGGCCCCAGTATAGGTTAAAGGTGGAAACACTGGGTTCCATAAGCCTGGTTTTTCCCCTAAGANAAGAATTCCCTGCGGGCCCCATGGCACTCTAAGGTGGCCCTCTGGGGAAATTTcccccccc
  3   1   2       bld He1  5g3  in                    IMAGE:4409109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTTTTGGAGCTCAAGCCCCCTTTGGAGGGTACAAGGCATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAA
  3   1   2       bld Ov1       in                    IMAGE:5049331.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGCATCAGATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGCAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAGTTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGTCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc2 5g3  in                    IMAGE:3747003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCAGGAATAGGCAGAGAGCTTGGAGAGTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAAAAAA
  3   1   2       bld Egg1                               PBX0002A09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTATGGACTTGAAGCATACACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCTTAAACGTGCTGTGAAAGGAAAACATCTGGGAAACTGTAGGGTTGGATCTGTTATTTTAAGAGTTCAGCAGTTACCTTTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAAAAAAAAAAAAAAAGATTC
  3   1   2       bld Sp1                             IMAGE:4175730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTAAACCCTTAATGCTTTCTGTAAGGCTTTTCTTTCCCCATAACATACAAAGCAAATCATATAAACCGTGCAGCAACACTTGCTTAAAGTCATGCCCAAAAAGAAAGCACTTAATTCTATGCACGGTTTTCATTTTGTTAGAAAACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTTTTTTTTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGCCGTATATTTCTGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ov1                             IMAGE:4055241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGTTTTCATTTTGTTAGAATACCCCTGGGCCTTGGTTGCTAGACATCCAAGCTATTTGCCCGAAATTAACATCCGTTGTTTGGGGACACCAACTTCACACTGGAATTTCTTCTTTCTGACTTCAAACTGTGACTTCCCACCATATACCAGCCGCAATATAGGCACTTGTAGTAACTCCTAATAAAGACCGTATATTTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)