Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6875336.3.5                    52 END     3           8        5                (no blast hit)
     2   2.0    0Xl3.1-XL091p04.3                            7 END     2           5       28                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL091p04.3                            7 PI      85        704     1064                (no blast hit)

 This cluster: approximate FL confidence score = 84%

 1012769211 Xl3.1-XL483f19ex.5 - 35 ESTs
                                                                       -90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL483f19ex.5                                                                                           TTCCCTAGAGCATCTTCTTCTTCATCATCGTCATCATCATCTTACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCC
                                                  Xl3.1-CHK-1012687593                                                                                                 AGAGCATCTTCTTCTTCATCATCGTCATCATCATCTTACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAA
                                                      consensus depths                                                                                                5    13    10    14    10    14    11    15    13    16    15    17    16    18    16    18    16    18    16    18    15    18    16    18    16    18    16    18    15    19    17    19    16    19    17    18    18    18    16    18    18    18    17    18    18    18    18    20    16    20    18    21    19    21    22    23    22    24    21    24    24    27    23    28    24    28    21    28    22    28    26    28    27    29    28    30    28    30    30    32    25    32    31    32    31    32    30    32    31    32    32    32    30    32    31    32    31    32    30    33    31    33    29    30    30    30    29    30    28    30    27    29    28    29    28    29    26    26    23    23    22    22    22    22    22    22    21    22    21    21    19    19    19    19    18    19    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    17    17    17    16    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    14    16    15    16    14    16    14    16
                                                                   SNP                                                                                                       G----------T
                                                                   SNP                                                                                                                   -----A------
                                                                   SNP                                                                                                                                                                                                                                                       -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                           T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------A-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                               BLH ATG      46     150                                                                                           
                                               BLH MIN      43      39                                                                                           
                                               BLH OVR      46     146                                                                                           
                                               CDS MIN      46      78                                                                                           
                                               EST CLI      -4      78                                                                                           
                                               ORF LNG      46       3                                                                                           
                                                                                                                                                   PROTEIN --- Ag ---- 5e-011     XP_316733.3 AGAP006699-PA [Anopheles gambiae str. PEST] =============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PREDICTED - Cf ---- 2e-011     XP_546734.2 PREDICTED: similar to hairy and enhancer of split 5 [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN --- Sp ---- 1e-011     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN --- Ci ---- 7e-013     NP_001071684.1 transcription factor protein [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN --- Dm ---= 4e-014     NP_524504.2 E(spl) region transcript mgamma CG8333-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN === Dr ==== 1e-014     NP_571684.1 hairy and enhancer of split related-7 [Danio rerio] ===================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                  PROTEIN --- Hs ---- 5e-015     NP_115969.2 hairy and enhancer of split 7 [Homo sapiens] =========================================================================================================================================================================================
                                                                                                                                                                                                                  PREDICTED - Bt ---- 4e-015     XP_875028.2 PREDICTED: similar to bHLH factor Hes7 [Bos taurus] ==================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN --- Gg ---- 3e-015     NP_001012713.1 hairy and enhancer of split 5 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                  PROTEIN --- Mm ---- 9e-016     NP_149030.2 hairy and enhancer of split 7 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN === Xt ==== 1e-076     NP_001039166.1 hairy and enhancer of split 7, gene 1 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN === Xl ==== 2e-102     NP_001082175.1 HES-related 1B [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL483f19ex.5                                                                                                                                         ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGA---------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------TAA------------------------------------------------------------------TGA------------ATG------------------------------TGA---------------------------ATG---------------------------------------------ATG
                                                                   ORF                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  3  -1   2       bld Ga11                            IMAGE:3475397.3p GAGTTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGCAGAGGGGACAAGTTCTTCCCTAGAGCATCTTCTTCTTCATCATCGTCATCATCATCTTACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTG
  5   1   2       bld Ga15 5g3  in                       XL509b01ex.5p                                                                               GGGACAAGTTTCTTCCCTAGAGCATCTTCTTCTTCATCATCGTCATCNTCATCTTACCATGAAGGGAACAAGTGAAGTCNAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGANGGAGAGGATAAATAACAGCCTGGAGAANCTGAGAATTTTCCTATCTCANACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCNGTTTCTCCAGTCCAGGAANCTTCTCCCACTGGATAGGGAAGCGGTGGATTANGAATACCAATCGGGGTTCCNGCATTGNCTGGAGACGACCTTGCATTTCATGANCTCCNAACCTGACATGAATGGTGTGACCAAGGAGNTGCTCTCCCACCAGATGTCCTCCTGTANGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCNTTGACNAAACACGTACCTTCCCTTAGCTACCAAGACTCNACACCGCATTTAGTGTCCAACAGCATCTCCATCANCCCTACGNAGACTCTGGTTGACAGTCATTTCACTTACCAANCCTTCAAGGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAAGGGTGCANGAA
  5   1   2       bld Ga15 5g3  in                       XL508b01ex.5p                                                                                GGGACAAGTTCTTCCCTAGAGcatcttcttcttcatcatcgtcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATTAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTANCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATAT
  5   1   2       bld Ga15 5x3                           XL426i05ex.5p                                                                                      CCNTAGNAGCATCNTTCNTTCTTCATCATCGNTCATCATCATCNTTACCATGNAAGGGAACAAGNTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGGAATGCTATGGGAAGGGACATTTTGTCTATG
  5   1   2       bld Ga15 5g3  in                       XL404c05ex.5p                                                                                       CTTCCCTAGAGCATCTTCTTCTtcatcatcatcatcatcatcatcTTACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAA
  5   1   2       bld Ga15 5g3  in                       XL517j08ex.5p                                                                                       CAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAGTGAGAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGATATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCA
  5   1   2       bld DMZ  5g3  out                        xl251o19.5p                                                                                       CAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAGTGAGAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAG
  5   1   2       bld DMZ  5g3  out                        xl319d09.5p                                                                                       CAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAGTGAGAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAA
  5   1   2       bld DMZ  5g3  in                         xl274k22.5p                                                                                       GTTCTTCCCTAGAGcatcttcttcttcatcatcgtcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCAT
  5   1   2       bld DMZ  5g3  out                        xl275b04.5p                                                                                       CAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAGTGAGAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAA
  5   1   2       bld Ga15 5g3  in                       XL419a17ex.5p                                                                                        TTCTTCCCTAGAGcatcttcttcttcatcatcgtcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGT
  5   1   2       bld DMZ                                  xl280a06.5p                                                                                         GGACAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcTTACCATGAAGGGAACNAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACTGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGA
  5   1   2       bld DMZ       in                         xl280b13.5p                                                                                          GACAAGTTCTTCCCTAGAgcatcttcttcttcatcatcatcatcatcttACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCAAACCCTGAAAAAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAA
  5   1   2       bld Ga12 5g3  in                         XL144j08.5p                                                                                                       TCTTCTTCTTCATCATCGTCATCATCATCTTACCATGAAGGGAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGC
  5   1   2       add Tbd7      out                        XL091p04.5p                                                                                                                               CATCATCACCATGAAGGGAGCAAGTGAAGTCAAACCCATGGAAGCTCATAGAAAGCTTTCAAAGCCGTTGGTGGAGAAAAGGCGACGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCTGAAGGTGGAGAAGGCTGAGATTCTGGAGTGCACAGTCCAGTTTCTCCAGTCCAGAAAACTTCTCCCACTGGATGGAGAAGCTGAGGATAAAGAGTACCAGTCAGGGTTCCAGCATTGCCTAGAGACAATCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAATGAGTTCCTCTCCCACCAGCTGTCCTCCTATAAGCCATCTCCAAACACCTGGAGTCCAACCTGTGCTCCACTGACAAAACACAAGCCTTCTCTTGGCTTTCAAGACTCAGTATCACATTTAGCTTCTAACAGCATCTCCGTCAGC
  5   1   2       chi Neu7      out                        XL009g18.5p                                                                                                                                     CACCATGAAGGGAGCAAGTGAAGTCAAACCCATGGAAGCTCATAGAAAGCTTTCAAAGCCGTTGGTGGAGAAAAGGCGACGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCGAAGGTGGAGAAGACTGAGATTCTGGAGTGCACGGTCAAGTTTCTCCAGTCCAGAAAACTTCTCCCACTGGATGGAGAAGCTGAGGATAAAGAGTACCAGTCAGGGTTCCAGCATTGCCTAGAGACAATCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAATGAGTTCCTCTCCCACCAGCTGTCCTCCTATAACCCATCTCCAAACACCTGGAGTCCCACCTGTGCTCCACTGACAAAACACAAGCCTTCTCTTGGCTTTCAAGACTCAGTATCACATTTAGCTTCTAACAGCATCTCCGTCAGCCCTACAAAGACTCTGGTTGACAGTCACTTCTCTCACCAAACCTTCAACACCTGGAGACCCTGGGTATGATAACTTTTTACCCTTAAATAGTGAAAGAATCATCACAAGGCTAGAATTATGGTCTACCTTGAGTGTTCAAGCAACC
  5   1   2      seed Ga15      in                       XL483f19ex.5p                                                                                                                                                GAACAAGTGAAGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATCTCAAACCCTGAAAAGTGAGAAACTAAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCCATGTATATAATGTATAGATTATGGAGTA
  5   1   2       bld Ga15      in                       XL447f12ex.5p                                                                                                                                                          GGTCAAACCCATGGAAACCCATAGAAAGCTATTAAAGCCGTTGGTGGAGAAAAGGCGGAGGGAGAGGATAAATAACAGCCTGGAGAAGCTGAGAATTTTCCTATTTCNAACCCTGAAAAGTGAGAAACTTAAGAATCCNAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGATATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAG
  5   1   2       bld Neu6                   IMAGE:4084597-IMAGp.IMAGp                                                                                                                                                                                                                                                                  CATTTTTCCCCCGGGGGGAGAAACTTAAGAATCCAAAAGTGGAGAAGGCTGAGATTCTGGAGTGCACGGTCCAGTTTCTCCAGTCCAGGAAACTTCTCCCACTGGATAGGGAAGCGGTGGATAAAGAATACCAATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGATATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGA
  3   1   2       bld Ga15      in                       XL447f12ex.3p                                                                                                                                                                                                                                                                                                                                                                     GGATAGGGAAGGCGGGGGATAAAGAATACCAATCGGGGTTCCCAGCATTGCCTGGAGACGACCTTGGCATTTCATGAACTCCAAACCTGATATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTTTACATAAAAACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATG
  3   1   2       bld Ga15 5g3  in                       XL508b01ex.3p                                                                                                                                                                                                                                                                                                                                                                      GGATAGGGAAGCCGGTGGATTAAGAATACCAATCGGGGGTTCCCAGCATTGCCTGGAGACGACCTTGCATTTCATGANCTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGNTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTNTATCACGCAGGCNCAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTNATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATG
  3   1   2       bld DMZ       in                         xl280b13.3p                                                                                                                                                                                                                                                                                                                                                                                                       ATCGGGGTTCCAGCATTGCCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGCAAGTCACCTTCTGACGCCTGGAGTCCCAACTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAATGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGAAGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTA
  5   1   2       bld Ga15      in                       XL503l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATTGTTTTCCTCCTGTAAATAAAACTTTACTTGAATCA
  3   1   2       bld Ga15      in                       XL503l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGAGACGACCTTGCATTTCATGAACTCCAAACCTGACATGAATGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATAT
  3   1   2       bld Ga15 5g3  in                       XL404c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                   CNTNGCATTTCCATGAACTCCAAACCTGACANGAATGGTGTGACCAAGGAGNTGCTCTCCCACCAGATGTCCTCCNGTAAGCCNCCTTNTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTACAATAT
  3   1   2       bld Ga15      in                       XL483f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATGAAATGGTGTGACCAAGGAGCNTGCTCTCCCNCCAGGATGTCCTCCCTGTAAGCCNCNTTNTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACNCCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATG
  3   1   2       bld Ga15 5g3  in                       XL419a17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATGAATGGGTGTGACCAAGGAGCTGCTCTCCCACCAGATGTCCTCCTGTAAGCCACCTTCTGACGCCTGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATAT
  3   1   2       bld Ga15 5g3  in                       XL509b01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATGAANGGTGTGACCAAGGAGCTGCTNTCCCACCAGATGTCCTCCTGTAAGCCACGTTCTGACGCCNGGAGTCCCACCTGTGCTCCATNGNCAAAACACGTACCTTCCCTTAGNTACCAAGACTCAACNCCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCANGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAANCTTCTGAGAATTGGATCAGCGNTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATT
  3   1   2       bld Ga15                               XL447p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGACCAAGGAGCTGCTCTCCCACCNGATGTCCTCCNGCAAGTCACCTTNCTGACGCCTGGAGTCCCAACTGGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTTTACATAAAAACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATG
  3   1   2       bld Ga15                               XL504e23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGTCCCACCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCNTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATAT
  3   1   2       bld DMZ  5g3  in                         xl274k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTGCTCCATTGACAAAACACGTACCTTCCCTTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTACAATA
  3   1   2       bld Ga12 5g3  in                         XL144j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGCTACCAAGACTCAACACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAACCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTCACCTTTGAAGGGTGCAAGAAGAGCCTCCAGGCTAGAATTATGGGTTCCCCAGGGTGTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTTTATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATTATGCATTTTACATAAAAACTTCTGAGAATTGGATCAGCGTTTCTTACATTTTATGTATATAGTATATGTATATTATTCCTATCTCACTATCCTTACAAATNTTTTCCTCCGTAAAAAACTT
  3   1   2       bld Tbd7                                 XL093k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTACCAAGACTCAGCACCGCATTTAGTGTCCAACAGCATCTCCATCAGCCCTACAAAGACTCTGGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAATGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTTTACATAAAAACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATATGTTTTCCTCC
  3   1   2       bld Neu4                            IMAGE:4084597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATCAGCCCTACAAAGACTCTGGTTGACAGTCATTTCACTTACCAAAGCTTCAAGACCTGGAGACCCTGGGTATGATGACTTTTAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTTTCAGGCACCTTGAATGCTATGGAAGGGACATTTTGTCTATGGCATGAAAATCTGCAGAACTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATACAGTGTAAATATAAGAGTTTGGACCTGGACTTTTATTTTACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTATATCATGTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCACGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTTTACATAAAAACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATAGGAATTCCTCCTGTAAATAAAACTTTCTTGGAA
  3   1   2       bld Ga15 5g3  in                       XL517j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGGTATGATGNNTTNNAATCTTTGAAGGGTGCAAGAAGAGCCACCAGGCTAGAATTATGGGTTCCCCAGGGTTNTCAGGCNCCTTGNATGCTATGGAAGGGACATNTTGTCTATGGCANGAAAATCTGCAGACCTATTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGCATGTATATNCAGCGTAAATATAAGAGTTTGGACCNGGACTTTTATTTNACTGATGCACCATTTGAGCACATTCCATACATGTACATGGGAGACTTCCATGTCCCTCAGTANATCATNTATATAATGTATAGATTATGGAGTATTTTGGATCTGTAGCTTGTATCAGCGCAGGCACAGAGTGGAAGGAGTCCTGAAAAGGAGCAGTTATGCCCAAATGATGCATTNTACATAAAACACTTCTGAGAATGGGATCAGCGTTTCTTACACTTTATGTATATAGTATATGTATATTTATTCCTATCTCACTATCCTTACAATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)