Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7981209.3                      15 END     4          12       26                TFIID subunit [Xenopus laevis]
     21.6699999999999999    0Xl3.1-xlnga003a09.3                         5 END     3           9       60                TFIID subunit [Xenopus laevis]

 This cluster: approximate FL confidence score = 93%

 1012769546 Xl3.1-IMAGE:3402030-IMAGp.5 - 31 ESTs
                                                                       .....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3402030-IMAGp.5                                                                  AAATGTCGCTTCTTACTTTCCCCGCCACCCACTGTAATTCGTCGTTTCTAATATGAGATAATGAACTAGGCACGCGGAGTTCAAACAGGTTCGCAAAGAGCATGAACGGACAGCAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGGTCAAGGCTCTTATGGACAATCCCACACTGTATCTGGAGAAATACCTGCAC
                                                  Xl3.1-CHK-1012687951                                                                        CGCTTCTTACTTTCCCCGCCACCCACTGTAATTCGTCGTTTCTAATATGAGATAATGAACTAGGCACGCGGAGTTCAAACAGGTTCGCAAAGAGCATGAACGxxxxxxAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGGTCAAGGCTCTTATGGACAATCCCACACTGTATCTGGAGAAATACCTGCACGAACTC
                                                      consensus depths                                                                       2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     5     3     5     3     5     3     5     3     5     3     5     4     6     6     8     7     9    12    14    17    18    18    20    18    21    18    21    18    21    18    21    18    21    18    21    18    21    19    21    20    21    20    22    21    23    22    23    22    23    22    23    21    23    21    23    22    23    22    23    23    24    23    24    22    24    24    24    24    24    24    24    23    24    23    24    22    24    23    24    23    24    23    24    22    25    24    25    23    25    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    22    23    23    23    20    20    18    20    16    18    15    18    14    17    14    17    13    17    11    16    11    16    10    16     9    16     8    15     8    15     8    14     7    13     7    13     6    10     6    10     6    10     6     9     5     9     5     8     5     7     5     6     5     6     5     6     3     4     3     4     3     4     3     4     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                          --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                               BLH ATG     255     810                                                                  
                                               BLH MIN     231     144                                                                  
                                               BLH MPR      12     144                                                                  
                                               BLH OVR     255      31                                                                  
                                               EST CLI     203      12                                                                  
                                               ORF LNG     255       1                                                                  
  5   1   1       add Egg4      out                   IMAGE:3744161.5p GGAATTCCTTTAAGCAGGAAGTTGCGTTCCACTCGAAGGCCTAAGAGGAGCGTAAATACACAGTGAAAATGTCGCTTCTTACTTTCCCCGCCACCCACTGTAATTCGTCGTTTCTAATATGAGATAATGAACTAGGCACGCGGAGTTCAAACAGGTTCGCAAAGAGCATGAACGACAGCAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCATGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTT
  5   1   2       bld Egg1 5g                            PBX0145F01.5p                  CGAGGGCGTTCCACTCGAAGGCCTAAGAGGAGCGTAAATACAAAGTGAAAATGTCGCTTCTTACTTTCCCCGCCACCCACTGTAATTCGTCGTTTCTAATATGAGATAATGAACTAGGCACGCGGAGTTCAAACAGGTTCGCAAAGAGCATGAACGACAGCAACGTTTAAATTCGCCGGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGAGCCGAGGCTCGTCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCACCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATT
  5   1   2       add Ooc2 5g3  out                   IMAGE:3746862.5p                                                       GGAATTCCTGAAAATGTCGCTTCTTACTTTCCCCGCCACCCACTGTAATTCGTCGTTTCTAATATGAGATAATGAACTAGGCACGCGGAGTTCAAACAGGTTCGCAAAGAGCATGAACGACAGCAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGAGCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTATGGATCTCCCAGATGTCGGATGAGACGTGTCAGCTGCTCGCACAGGAGGTCAGCTTCCTGATCAAGGAGGTCACTCAAGATGCCCTGAAGTTCATGCATGTGAGGAAGAGGCAGATGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGATGCGATCTACGGCTTGCACCCCAATGAGTTCCTGCCTTTACGATACGCCAGTGGCAGGGGCCAGGTAGTTGATCTGCTATGAAAAGAAAGAGACCGATCTCAGCGACATTATGATGACCCCGTTGGCCGTGTTTCGACTGGTGTATCTCTTAGATGCTACTGGCTG
  5   1   2       bld Emb1 5g                IMAGE:6632170-IMAGp.IMAGp                                                                                                                                                                             CGACAGCAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGA
  5   1   2       bld Emb1 5g                         IMAGE:6632170.5p                                                                                                                                                                              GACAGCAACGTTTAAATTCGCCAGTCTGTTTCCCTGTCAGGACCTGCGAGCTCAGAAGCGCGGGGCCGGAAGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGNGTCAGGAGAGGGGCAAAGGAAAGGAGGAAGAAAACGGCCATCTTTGGAAAGGGGCTCCCTTTAAAGCTGGAAGCCGGCGTAGTATCCCACGAAGCTTTCGGGTGGAACAGCAGCTGGTATTATAAGGGAGGATTTACGGAGGGCGTGCCGTTTGGTTTCCTGGTGAGGCCCAAGAA
  5   1   2       bld Oo1  5g                         IMAGE:6638837.5p                                                                                                                                                                                                                                           GCGATCCGGAAGTTACCTGCCAGCCGTAACGAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCACAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCANAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACCGAGGCCGTGCGTTGGTTTCCTGTGAGGCCAAAGAGAGCGGAAAGCCCTTGCCAGAGCATTTGCCACCCGACCCAGGCCCTGTACCAGATGGTTACCCCCGGATTTAA
  5   1   2       bld Egg1 5g                            PBX0038A04.5p                                                                                                                                                                                                                                               CACGAGGTTTACCTGGCAGCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAG
  5   1   2       bld Em10 5g                         IMAGE:7981957.5p                                                                                                                                                                                                                                                                 GCCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGCGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAACGGCCATCTTGGAGGGGCTCCTTTAAGCTGAAGCGCGTAGTTCCACGAGCTTCGGTGGACAGCACTGTATATAGGAGATACGGAGCGTGCGTTGTTCTG
  5   1   2       bld Egg1 5g                            PBX0150E06.5p                                                                                                                                                                                                                                                                  CCGGAAGTAGCCTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTG
  5   1   2      seed Emb1 5g                IMAGE:3402030-IMAGp.IMAGp                                                                                                                                                                                                                                                                             CTGGTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGGTCAAGGCTCTTATGGACAATCCCACACTGTATCTGGAG
  5   1   2       bld Em10 5g                         IMAGE:8317862.5p                                                                                                                                                                                                                                                                                GTGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGTGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGGACAGCAGCTGTATT
  5   1   2       bld Ga15      in                       XL479h17ex.5p                                                                                                                                                                                                                                                                                 TGATAGTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGCGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGC
  5   1   2       bld Em10 5g                         IMAGE:7981050.5p                                                                                                                                                                                                                                                                                      GTGTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCGGCCAGGCAAGGTCAAGGGTCAGGAGAGGGCAAGGAAAGGAAGAGAAAACGCCATCTTGGAAGGGGCTCCTTTAAGCTGAAGCCGCGTGTATCCCGAGCTTTCGGTGGACCGCACCGTATATAAGGAGTTACGAGGCGTCGTTGTTCCGTGAGCCAAAGAGGGACCTTGCAGACATTCTCGACCAGCCTGACAATGTACCTATTTCCTTTATATCTAGGGGGAGTAG
  5   1   2       bld Em10 5g                         IMAGE:8317597.5p                                                                                                                                                                                                                                                                                        GTGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTANTAGGAGATTACNGAGGCGTGCGTTGGTTCCTGTGAGGCAAGAGAGCGGAAGCCTGCGA
  5   1   2       bld Te2N 5g                         IMAGE:7766574.5p                                                                                                                                                                                                                                                                                         TGGAAAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGA
  5   1   2       bld Ooc3 5g                         IMAGE:3436320.5p                                                                                                                                                                                                                                                                                           AAGGGGGAGCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCACTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGCGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGA
  5   1   2       bld Emb9 5g                         IMAGE:7977379.5p                                                                                                                                                                                                                                                                                             AAGGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGCGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAATTGCCATCTTGGACGGGCTTCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCCGTGGAACAGCAGCTGTATATTAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGATAGCGGAAGCCTTGCCAAGCATTACACCGACCAGTCCTGTACCAATGTTAACTCGAATTAGCCACTTCATATCCAAGTGGTGCGGAG
  5   1   2       bld Neu7 5g3  out                        XL016d17.5p                                                                                                                                                                                                                                                                                               GGGGGTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGT
  5   1   2       bld DMZ  5g                              xl324p03.5p                                                                                                                                                                                                                                                                                                   GTCCGAGGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCACAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGANCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGANGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAANGTCANGGGTCAGG
  5   1   2       bld Em10 5g3  out                   IMAGE:7981209.5p                                                                                                                                                                                                                                                                                                         GGCTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGCGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAGGAGATACGGAGGCGTGCGTTGGTTCTGTGNAGCAAGAGAGCGGAGCCTGCAAGCATTGCACGACCCAGCTGTACAGATGTACCGATTAGCATTCATTCGAGGGGGCGATGACTATGCAACATCGGCTGCTTAATCC
  5   1   2       bld Neu7 5g                              XL036c07.5p                                                                                                                                                                                                                                                                                                          CTCGCCTGCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCAGTGAGTCCATGAAAGTGATCTCAGAGTCCGTAGGGATCTCCCAGTATGTCGGAGGAGACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTANAGCCGATCTACNGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGNGTNCCACTGGATGTATCTCTCAAAGCTCATTGGC
  5   1   2       bld Ga18 5g3  out                      xlk68m13ex.5p                                                                                                                                                                                                                                                                                                                   GCGCTCTCATCCATCATGGCGGAGGGGAAGAAGATCGGGAACACTCTTCTCCCCNGNGAGNCCNTNAAAGTGATCTCAGAGTCCGNNGNNTCTCCCAGATGTCGGAGGAGACGNGTCAGCTGCTCGCCCAGGAGGNCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGNTCATGCATGTGGGGAAGAGGNAGAAG
  5   1   2       bld Ov1       out                   IMAGE:5048421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGTGTCAGCTGCTCGCCCAGGAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTA
  5   1   2       bld Neu7                                 XL020e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCGCCCAGGNAGGTCAGCTTCCGGATCAAGGAGGTCACTCAGGATGCCCTGAAGTTCATGCATGTGGGGAAGAGGCAGAAGCTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAG
  5   1   2       bld Egg1                               PBX0100A12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGACACCCAGTGATATTGATGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTACGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGGGGCCGTGAGTTGCATTTCTATGAAGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAAGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATG
  5   1   2       bld Tbd7      out                        XL066l01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGCACTGAAACTGAAAAATGTAGAGCCGATCTATGGCTTCCACCCCAAGGAGTTCCTGCCTTTCCGATACGCCAGTGGCGGAGGCCGCGAGTTGCATTTCTATGAGGAGAAAGAGACCGATCTCAGCGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGG
  3   1   2       bld Ga15      in                       XL479h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTATGAAGAGAAAGAGACCGATCTCAGNGACATTATCAGCACCCCCTTGCCCCGTGTTCCACTGGATGTATCTCTCNAAGCTCATTGGCTGAGCANTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTNCTCCAGTCCCTAAGGAACAGCAGAAGANTGAAGCCACAGAACCTCTGAAGGTAGCCANACCANGACAAGAAGAAGGTCTGCCANGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCANCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCNTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGCAGCCCTCCCCTCNTCNTCTTGCAACAGAGACTTCCACTCTGTGACANTAACTGTGTGTGTGTGTGTGTGTATATGTGTGTGTGTGTGTGTGTGTGTGAATGTGCGTGCGTTAGAAGTTGTTATAGTACCTCTGTGCCTGTTCTCTCCCTGCATTAC
  5   1   2       bld Tbd7                                 XL077f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCCCCTTGCCCCGTGTTCCCTGGATGTATCTCTCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACAGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGGTCAAGGCTCTTATGGACAATCCCACACTGTATCTGGAGAAATACCTGCACGAACTCATTCCCGCAGTGATGACCTGTATCGTGAGTCGGCAGTTGTGCTTGCGGCCGGATGTGGACAATCACTGGGCTCTGAGAGACTTTGCGGCCAGACTGATTGCGCAGATCTGCAAGAATTTCAGCACC
  5   1   2       bld Em10                            IMAGE:8321466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATCAAAGCTCATTGGCTGAGCATTGAAGGAGTGCAGCCTGCCATTCCAGAAAACCCTCCTCCAGTCCCTAAGGAACAGCAGAAGACTGAAGCCACGGAACCTCTGAAGGTAGCCAAACCAGGACAAGAAGAAGGTCTGCCAGGCAAAGGTCAGGGGTCAGGAGAGGGCAAAGGAAAGGAGAAGAAAACGGCCATCTTGGAAGGGGCTCCTTTAAAGCTGAAGCCGCGTAGTATCCACGAGCTTTCGGTGGAACAGCAGCTGTATTATAAGGAGATTACGGAGGCGTGCGTTGGTTCCTGTGAGGCCAAGAGAGCGGAAGCCTTGCAGAGCATTGCCACCGACCCAGGCCTGTACCAGATGTTACCCCGATTTAGCACTTTCATATCCGAGGGGGTGCGAGTGAACGTAGTGCAGAACAATCTGGCATTGCTTATATATCTCATGCGCATGGTCAAGGCTCTTATGGACAATCCCACACTGTATCTGGAGAAATACCTGCACGAAACTCATTCCCGCAGTGATGACCTGTATCGTGAGTCGGCAGTTGTGCTTGCGGCCGGATGTGGACAATCACTGGGCTCTGAGAGACTTTTGCGGCCAGACTGATTGCGCAGATCTGCAAGAATTTCAGCACCACCACCAATAACATCCAGTTCAAGGATCACCAAAACATTCACCAAGGACTTGGGTTGATGATCGCACTCCATGAACG
  5   1   0       add Ga14                              Ga14-p16h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGTCTTNGCTCTTATGGACAATCCCACACTGATATCTGGAGAAATACCTGCACGAACTCATTCCCAGCAGTGATGACCTGTANCGTGAGTCGGCAGTTGTGCTTGCGGCCGGATGTGGACAATCACTGGGCTCTGAGAGACTTTGCGGCCAGACTGATTGCGCAGATCTGCAAGAATTTCAGCACCACCACCAATAACATCCAGTCTAGAGATCACCAAAACATTCACCAANACTTGGGTTGATGATCGCACTCCATGGACGACTCGCTATGGATCCATTGCAGGTCTTGCTGAACTGGGACCTGATGTGGTTAAGACGCTGATAGTCCCACGACTGACAGTGGAAGGGGAGGAGGCT
  5   1   0       add Ga14                                Ga14-p5g8.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGGCTCTGAGAGACTTTGCGCGCCAGACTGATTGCGCAGATCTGCAAGAATTTCAGCACCACCACCAATAACATCCAGTCTAGGATCACCAAAACATTCACCAAGACTTGGGTTGATGATCGCACTCCATGGACGACTCGCTATGGATCCATTGCAGGTCTTGCTGAACTGGGACCTGATGTGGTTAAGACGCTGATAGTCCCACGACTGACAGTGGAAGGGGAGAGGCTTCGCTCTGTATTGGACGGACCAGTCATATCCAACATAGACAAGATCGGAGCGGATCACGTGCAGAGCCTCTTACTGAAACACAGCGCCCCGGTCCTTGTTAAGCTCCGCTCTCCTCCGGATTCCCCCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)