Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5085334.5                      47 END     1           3        2                similar to growth arrest and DNA-damage-inducible, alpha [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5085334.5                      47 PI      84          9     1142                similar to growth arrest and DNA-damage-inducible, alpha [Xenopus laevis]

 This cluster: approximate FL confidence score = 92%

 1012769978 Xl3.1-xl258o16.5 - 33 ESTs
                                                                       ......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl258o16.5                                                         GGAGTCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTTATTTTATTTTTTTACAATAAAACGTTTGAAT
                                                  Xl3.1-CHK-1012687752                                                               AGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTTATTTTATTTTTTTACAATAAAACGTTTGAATTGGCAA
                                                      consensus depths                                                              5     6    10    12    13    13    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    16    17    17    17    17    17    17    17    15    17    17    18    16    18    17    19    17    19    18    20    16    22    19    22    17    22    18    23    18    23    19    23    19    23    17    23    19    23    19    23    18    23    12    22    14    22    14    23    13    22    12    23    13    24    13    24    13    24    11    23    12    23    10    23    11    22    10    22    10    21    11    19    11    17    11    15     9    14     9    13     9    13     8    13     8    13     9    12     8    12     8    12     8    12     9    14     9    14     8    12    10    12    11    13    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    13    14    13    14    13    14    13    14    12    14    12    14    12    14    11    14    11    14     7    12     5     8     4     4     2     4     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGTAGAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAATGGGTGCCTGTGATTAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTAACTGCAG
                                                                   SNP                                                                     T-----------
                                               BLH ATG     160     605                                                         
                                               BLH MIN     148      56                                                         
                                               BLH MPR      79      56                                                         
                                               BLH OVR     160      60                                                         
                                               EST CLI       3      29                                                         
                                               ORF LNG     160       1                                                         
                                                                                                                                                                                                              PROTEIN --- Ag ---- 8e-007     XP_308219.4 AGAP007651-PA [Anopheles gambiae str. PEST] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 1e-009     NP_610264.1 CG11086-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PREDICTED = Cf ==== 2e-044     XP_542187.1 PREDICTED: similar to Growth arrest and DNA-damage-inducible protein GADD45 beta (Negative growth-regulatory protein MyD118) (Myeloid differentiation primary response protein MyD118) [Canis familiaris] ==================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 2e-053     NP_001002216.1 growth arrest and DNA-damage-inducible, alpha [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 6e-059     NP_001038143.1 growth arrest and DNA-damage-inducible, alpha [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 6e-059     NP_031862.1 growth arrest and DNA-damage-inducible 45 alpha; growth arrest andDNA-damage-inducible, alpha; Gadd45alpha; DNA-damage inducible transcript 1 [Musmusculus] ================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Bt ==== 4e-060     NP_001029419.1 growth arrest and DNA-damage-inducible, alpha [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 1e-060     NP_001915.1 growth arrest and DNA-damage-inducible, alpha; DNA-damage-inducible transcript1; DNA damage-inducible transcript-1; DNA damage-inducible transcript 1 [Homosapiens] ========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 4e-082     AAI21533.1 Growth arrest and DNA-damage-inducible, alpha [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 5e-087     NP_001079537.1 similar to growth arrest and DNA-damage-inducible, alpha [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl258o16.5                                                                                                                                                                TAG------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------TAAATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------TGA---------------------------------------------------ATG------------------------------------------TAG------------------ATG---------------------------------------------------TAA------------------------------------ATG---------------------------------------------TGA------TGA------ATG------------------------------TAA------TGA
                                                                   ORF                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783021.5p GCACGAGGGTGTGCGTATGAAAGCCGGGCTAGTGAGCGCGTGAGAGTTGAGTGTGTGGAGTCAGCAAGTGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCCCCCTGATCCAGGCATTTTGCTGTGAAAATGACATCAACATCCTGAGAGTGACCAACATGAGTCGGCTGGCCAAAATCCTTGGCGGCTCTGAACAGCCAGGGGAACCTGCTGATCTGCATTGAATTCTAACCAACAACCCC
  5   1   2       bld Kid  5x3                        IMAGE:7008348.5p                                 CCCACGCGTCCGCCCACGCGTCCGGGAGTCAGCAAGTGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATNTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCCAGTTAAATGAAATTTTTAAAAAAACAATTACTTTCAGAAGAAAGTAAA
  5   1   2       bld Em10 5x                         IMAGE:7979320.5p                                       TCGGTCCGGATTCCCGGGAGGAGTCAGCAAGCGAAGACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCGGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCTTGAAGCCTGACTGCAGAGGACCATCACCATTGGGGTGTGCGAGGCTGCAAAACTCCTTAATGTGGACCCAGACGATGTAGTGCTTTGTTCTGTTGGCTACTGATGATAAGGACGGTCAGGGTGTCGCTTTAGAGATTCTTTTCACCCTGATCCTTGCATTTTGCTGTGATATTGACGGCAACATCCTGAGAGTGAGCAACATGTATCGGCTGGAATAGATCCTGGGCGGATCTGACTGTCAAGGGGATCCTGCTTATTTGCATTGTATTCTAATCAACAACGCCCGTGAACTAGGTATGTGGATGGTGCTCTATATTAGGAATTCTTATTCAAAAAAGTGGTTAATGGCACTATGGGTGCTGAAATTAGCTCCTGACTGGTTACCTTTAGGTTCATGTATTGACTGCTTGGATGGATTGTATATATGTAGTTTTCTGAAAGTGAAAACTTGTAGAGTTTGTCCCAGTGTTTTTGTGTTCTAATCTGGGAAGTTGTATCATTGTGTAGCTTTGATGGTGTTCAATAATCTCTTTTCCTTGTC
  5   1   2       bld Tad1 5x                         IMAGE:6878153.5p                                            GGGAGTAGTGTGTGGAGTCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACCTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACCTCCACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAAGATCCCTGGGCGGCTCTGACAAGCCAGGGGAAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAAATACAGATCAAGGGATTCCTGCCTCCTCAAGAAAGTGATTTGTTACTGCCAAAGAAAGTCGTTTATCTGGGACCAATGGGTGCCCTGTGGATTTACCCTGCCCGAAGCGAATGATTACCTTCCCGCGGTACCACTTTTAATTTTAACTGCCGGTTTTAAAGGAAAATTTTTTaaaaaaaaaaaaaTTTATCTTTCCCAGGAAGAATAAGTAAACCCCTTTTTCCCCG
  5   1   2       bld Emb4 5x3                        IMAGE:5572415.5p                                                CCACGCGTCCGAGTCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACCTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaTTACTTTCAGGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCCTAAAGCAAAGATTTCCATAACTCACCTAAAACATCACGAGGGAAGGATTTTGGGGATATGGCGAAACCCGGGTTAGAGGCCCCTCCTGGAAATGGAAGACTGTTTGGCCCAAAAAAA
  5   1   2       bld DMZ  5g3  in                         xl311c21.5p                                                       GTGGAGTCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACNGCGTACCATTATAATTTAACTGCAGTTTA
  5   1   2       bld Ov1  5x3                        IMAGE:6316994.5p                                                            GTCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaTTACTTTCAAGAAGAAAAGTAAACACTTTTTCCAGGGACCGGGTTCTGCCATAAAGCCAAAGATTTCAATAACTTACCATAAAAACATCCACCAGGGGAGGGATTTTTGGGGATATGGCAGAAAACCCGTGGTAAGAGGGGCACCTCATGGAAAATGGGGGAG
  5   1   2      seed Ov1  5x3                        IMAGE:8328009.5p                                                             TCAGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaaaTAC
  5   1   2       bld Ga15 5g3  in                       XL490f12ex.5p                                                              CAGCAAGTGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACGTAGAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaTTACTTTCAAGAANAAAAGTAAACACTTTTCCA
  5   1   2       bld Ga15 5g3  in                       XL478j12ex.5p                                                               AGCAAGCGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACCNCCCACCTGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCCTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl258o16.5p                                                                 CAAGTGAAGAACACGGGACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaT
  5   1   2       bld Ga12 5g3  in                         XL160n05.5p                                                                    GGAAGAACACGGGNACAGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACCTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGA
  5   1   2       bld Ga12 5g                              XL155c19.5p                                                                               GGGACAGTGCTGAGCTATTATGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAAC
  5   1   2       bld Ga12 5g3  in                         XL151f03.5p                                                                                    GGTGCTGAGCTATTGTGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAAACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACACTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTA
  5   1   2       bld Ga12 5x3                             XL186e16.5p                                                                                     GTGCTGAGCTATTATGTATCGGCAATTCGGAGAACTGAGGTGAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTTaaaaaaaaaaTTACTTTCAAGAAGAAAAGTAAACACTT
  5   1   2       bld Egg1 5g                         IMAGE:4678549.5p                                                                                                                  GAGAACTGTGGCCAAACTTTCCAGAGCCCAGAAAGAGCCTCGTTACTAGTGTCAGCGTCCAGTTGATCTGTGCAGAGGAGTGCAACGTGCGCATCGCTATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCATTTTTGTGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCTTACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACATGAATTACAGATCAAGGATCCTGCTCTC
  5   1   2       bld Ga15                               XL491f12ex.5p                                                                                                                                                                                                                                                                GGAAAGATGGAATCCGTGGGAAATGCATTGGAGGAAGTACTCCATGAAGCCAAACTGCAGAGGACCATCACCATTGGGGTGTACGAGGCTGCAAAACTCCTTAATGTGGACCCAGACAATGTTGTGCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACGTAGAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCANAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTaaaaaaaaaaaTTAC
  5   1   2       chi Neu7                                 XL032h01.5p                                                                                                                                                                                                                                                                                                                                                                                             GCTTTGTCTGTTGGCTACTGATGATAAAGACAATCAGGATGTCGCTTTACAGATTCATTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACGTAGGTAACACTCGTGTGGGGGCTGCAAGGATGGGCTTGGGTGGGTTCTGTGGTTTGCATAAGGAGACAATTACCAAGGGGCTTTTTAAACAGCTTACTGTGAGTCCTTTCCATTTATCCTGTTGATTGCTATTTAAATGCTGAATAATGAATCAACACTGCTTGTTTAGCAATGCTATAGTGCTGGGATGCTCACTGCATTCCCACAAATAGTAATGCTTCCTCCTATTATGGTGAAAAGTACCATTGTTTAAAAAGCACTTATAACTCTAGGTTATGTTCCCTTTGAAAATGTGTAGGCATAGTTTATTATATGCACAGCACCGTCCTTCTCTGCATACTTTTAATCTTAATCCAATGTAGAGGTGGGAGCAG
  3   1   2       bld Ga15 5g3  in                       XL490f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                          GCTNCTGATGATAAAGACAATCAGGATGTCGCTTTGCAGATTCATTTCCCCCTGATCCAGGCATTTTGCTGTGAGAATGNCATCAACATCCTGAGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTNTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTNTAATCAACGTAGAACCCCCNTGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATNTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCNCATACAGCGTNCCNTTATAATTTAACTGCAGCNTAAATGAAATTTTTAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTATTTAC
  3   1   2       bld DMZ  5g3  in                         xl258o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGATTCATTTCACCCTGATCCNGGCATTTTGCTGTGAGAATGACATCAACNTCCTGAGAGTGAGCAACNTGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCNCNTGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCNCATACAGCGTACCNTTATAATTTAACTGCAGTTTAAATGAAATTTTTAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTTGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACCAAGTGAAATGAAATG
  3   1   2       bld Ga15      out                      XL476b11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                GATTCATTTCNCCCTGATCCNGGCATTTTGCNGGGAGAATGNCATCAACNTCCTGGGAGTGAGCAACATGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACANGCCAGGGGAACCTGCTGATCTGCNTTGTATTCTAATCAACNACCCNCATGAATTNCAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTANCCTGCCAGAGCGATGATCNCATACAGCGTACCNTTATAATTTAACTGCAGTTTAAATGAAATTTTTAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTATTTAC
  3   1   2       bld DMZ                                 rxl256m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGCATTGTATTTTAATCACCAGTTGAAGTATTTCTGGTCATGTGATCTGAGGCNGCACAGAGNCCNTCNCGAAATGGTGGCTCANGGCAAGAGATGTAAAAGGCCAATATTTNCTTAAATATATATTCCAGTTTGAACCCACATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTNCNGCAANGAAAGTCGTTATCTGGACCAATGGGTGCCTGTGATTNACCTNCCAGAGCGANGATCACATACAGCGTACCNTTATAATTTAACTGCNGTTTAAATGAAATTTTTNAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCCCTCATGAAATGGAGGNCTGTTGGCCAAAANGANCCGNGCAGAGCTGTACTTTGCNCCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAACGGAAAATGTATGTTATGGCAAAGGAATAGGAA
  3   1   2       bld DMZ  5g3  in                         xl311c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAATGACNTCAACNTCCTGAGAGTGAGCAACNTGAGTCGGCTGGCCGAGATCCTGGGCGGCTCTGACAAGCCAGGGGAACCTGCTGATNTGCATTGTATTNTAATCAACAACCCNCNTGAATTACAGATCAAGGATCCTGCTNTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTNTCTGGACCNATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCNCNTACAGCGTACCCTTATAATTTAACTGCNGTTTAAATGAAATTTTTAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCTCACAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACCAAGTGAAATGAAATGTTT
  3   1   2       bld Ga12                                 XL161n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGAATTACAGATCAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAAAGTCGTTATNTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGNGATGATCACATACAGNGTACCATTATAATTTAACTGCAGTTTTAAATGAAATTTTTAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTTATTTTATTTTTTACAATAAAACGT
  3   1   2       bld Ga12 5g3  in                         XL160n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCAAGGATCCTGCTCTCAAANAAGTGATTTGTTACTGCAAAGAAAGTCGTTATTTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGGCNAGTTTAAATGAAATTTTTAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGAC
  3   1   2       bld Ga15 5g3  in                       XL478j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGNGNTTTGTTNCTGCAAAGAAAGTCNTTATNTGGNCCNATGGGNGCCTGNGATTANCCTGCCNGAGNGANGATCNCNTNCNGCGTNCCCTTATAATTTAACNNCNGNTTAAATGAAATTTTTAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCTCACAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAA
  3   1   2       bld Ga12 5g3  in                         XL151f03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTACTGCAAAGAAAGTCGTTATNTGGACCAATGGGTGCCTGTGATTAACCTGCCAGAGCGATGATCACATACAGCGTACCATTATAATTTAACTGCAGTTTAAATGAAATTTTTAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAACACTTTTCCAGGACCAGGTTCTGCCATAAAGCAAAGATTTCAATAACTCACATAAAACATCACGAGGGAGGATTTTGGGATATGCAGAAGCCGTGTAGAGGTCACTCATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAAATTTTATTTTATTTTTTTTACAATAAAACGT
  3   1   2       bld Ga18      in                      xlk118b06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAATGGAGGACTGTTGGCCAAAAAGAACCGTGCAGAGCTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTTAANTTTTANNT
  5   1   2       bld Ga18      in                      xlk118b06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAAATGGAGGNNTGTTGGCCAAAAAGAACCGTGCNGAGTGTACTTTGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGttttttaaattttattttatttttttacaataaaacgtttgaattggcaaaaaaaaaa
  3   1   2       bld Egg1 5g3  in                    IMAGE:4783021.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCACCAATGAGTATCAAAAAAGATTACCTGAAATTAAGGAGGATTGGAAAATAGTTCAGGCTGCCATATGAAATGGAAAATGTATGTTATGGCAAAGGAATAGGATTTAATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTGGAATAATATTTTATTTTTTTACAATAAAACGTTTGAATTGGCAAA
  3   1   2       bld DMZ                                 rxl239l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATGTTTTTAAATTTATTTATT
  3   1   2       bld DMZ                                 rxl276g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACAATGGCTTTTATGCAGGAAGTTGTTGAGACAAGTGAAATGAAATG
  3   1   2       bld DMZ                                 rxl331c16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTGTTCTAGGTTTATAAAATGTTAAATTATTTTGTTTATGCTATTGTTCTTTAATGTATTCTTTAGCAAATTGGTACCAATGGCTTTTATGCAGGAAGTTGTTGAGACCAAGTGAAATGAAATGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)