Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7020631.5                      13 END     2           6       15                coatomer protein complex, subunit alpha [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8075404.3                      28 PI      91          1     1578                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7205357.5                       5 PI      91          1      123                hypothetical protein LOC100158562 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012770239 Xl3.1-IMAGE:4056195-IMAGp.5 - 33 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4056195-IMAGp.5                                        CTGACAGCCGCCACCCATGGAATCAACGATGAAGAGGAGAGCTTGAGGGAGTCCTTTGACCCAGAAAAAGAAATAATTCCAGAGGTCGACCCTGATGCTATACTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAACTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGATGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATT
                                                  Xl3.1-CHK-1012687763                                              GCCGCCACCCATGGAATCAACGATGAAGAGGAGAGCTTGAGGGAGTCCTTTGACCCAGAAAAAGAAATAATTCCAGAGGTCGACCCTGATGCTATACTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAACTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGATGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTAAAAAA
                                                      consensus depths                                             3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     8     6     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     4     8     6     9     6     9     6     9     6     9     6     9     6    10     7    10     8    10     7     9     7    10     7     9     7     9     8     9     8     8     7     8     8     9    10    11    10    11    10    11    10    11    11    13    11    14    14    16    14    17    17    18    16    17    15    20    19    20    19    20    19    20    20    20    20    20    20    21    21    21    21    21    21    21    22    23    19    23    20    24    20    24    20    26    20    26    25    26    25    26    24    26    24    26    23    26    23    26    23    25    23    25    23    25    23    25    23    25    22    25    22    25    22    25    21    25    19    25    18    25    19    23    17    23    18    23    18    22    18    22    18    22    17    22    15    21     8    16     8    14     8    13     6     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                --C-----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    G-------C---
  5   1   2       bld Neu7      in                         XL012d16.5p GGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCATGGAATCAACGATGAAGAGGAGAGCTTGAGGGAGTCCTTTGACCCAGAAAAAGAAATAATTCCAGAGGTCGACCCTGATGCTATACTGCTGATGcccccaccccccATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGACGCTGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCC
  5   1   2       bld Em10                            IMAGE:8320204.5p                                        CTGACAGCCGCCACCCATGGAATCAACGATGAAGAGGAGAGCTTGAGGGAGTCCTTTGACCCAGAAAAAGAAATAATTCCAGAGGTCGACCCTGATGCTATACTGCTGATGcccccaccccccATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAACTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGATGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCCAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACTTTCTCCGGGGTCGCAGCACTTACCANGCCCTGCCAGGTCTCCTGCCATGTATGCTACCCTCACGTATTTGGAAGACGCTGCTTGAGAACGGCTTCCTGTGTTGGCTGAACTCACGACTGATCAAGCTACACTTTCTACATTCATATTCGGCAGTTTAGAGCTGGGAAATTCCGCTATCTCTACGGCCCTCTGCTGA
  5   1   2       bld Em10                            IMAGE:8320307.5p                                        CTGACAGCCGCCACCCATGGAATCAACGATGAAGAGGAGAGCTTGAGGGAGTCCTTTGACCCAGAAAAAGAAATAATTCCAGAGGTCGACCCTGATGCTATACTGCTGATGcccccaccccccATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAACTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGATGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTCCAGGCCCTGCAGGTCTCCCTGCATGTATGGCTACCTCACGTAATGAANNGACGCTGCTGAGACGGCTTCTGCTNGTGCTGAGCTCACGACTGATCACGCTACGCTCGCACAGTCATACTCNGCAGTTGAGAGCTGTGAAGTTCGTATCTCTACTGCCTCTGCTGATATACAAATCAAGCACCTTCTT
  5   1   2       bld Lmb1                            IMAGE:8533995.5p                                                                                                                                                                CCCATCATGCCTCTGGACACTAATTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGACGCTGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAACAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGCCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAAGCTCACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGGCAGTTTGANGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATNNATAGCAGAGATTCAGAGGCCAGCAGCTGATCACTATTGTCGG
  5   1   2       bld Emb9      in                    IMAGE:7975960.5p                                                                                                                                                                                          GCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGAAGCATTGCAAACAAAGGTAAGGGTGGAGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAACTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGATGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTCTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAATCTCAACGACTTGATTCCACTCTTACAGCTTCTGCTTACCATTTCACTACTTCCGGTAAGTTTGAGGACGCTGTGGAGATATTCCCTGCTTATCCTTTTCAGCTTGCCCTGCCTTGTTTGAAATATA
  5   1   2       bld Tbd7      in                         XL056b18.5p                                                                                                                                                                                                                                                         GGCACTGGCTGCAGATATCGATGTGGATACTGTGGGAGGTGAAGGCTGGGGAGAAGACGCTGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGGGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCATGAAGAGGGTGAAGGATGGGATGTGGAGGAGGATCTTGACCTTCCCCCTGAGCTGGATGTTCCCTCTGGCCCGTTTGGCTCAGCTGAAGATGGCTTCTTTGTGCCCCCAACTAAAGGCAGCAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGCCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTTACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGC
  5   1   2       bld Tbd7      in                         XL101l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTTGTGCCCCCAACTAAAGGCAACAGTCCAGCTCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACATCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGA
  5   1   2       bld Emb4                            IMAGE:4970274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCATGACCAAGTTGGCGTGGTAAACTTTGGCCCATTTAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAA
  5   1   2       bld Brn3                            IMAGE:8536577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCCGGGGTCGCAGCACTTACCAGGCCCTGCCAGGTCTCCCTGCCATGTATGGCTACCCTCAACGTAATTGGAAGGACGCTGGCTTGAAGAACGGGCTTCCTGCTGTTGGCCTGAAGCTCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACTGTAGAGAAATGCCATTGAGTGGGCTGCTACACCCTGAGTCAAAGACAATCTGTNGGTCACACATGAAGAATCGCAAGAGTGATTGGTGAGATCATCTCTCATTCGTAACACACTGCACTTGCGACGCCATTTCTTTCCGAGCTGCTGGTGCGATACCTCTCTGAACGTCATGTGATGTA
  5   1   2       bld Tad1                            IMAGE:6937976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAACGACTTGATACAACGCTTACAGCTCTGCTACCAGTTCACTACTTCCGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATAGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGTATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTTAGCACCAACGTGCGATCTGTGCGGGAGCTGCACCATTTTCCCCTTTTC
  3   1   2       bld Emb9                            IMAGE:7975901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTGAGGAGGCTTGGAGAGATTCTGGTGATCCTTTTCAGCGTGCCGCTGCTTTTTGGGGATAATAAACAAGAAGATTCTAGAGGGCCCACCAGCTGATCACTATTTGTCGGGAATACACTGTTGGTCTGTCAATGGAGATAGATCGCACGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCAGTGAGATGGCCGCCTATTTCACACACTCCAGCGTGCAGACCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCTTAGAGCTCGGTCTCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATATGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATCGCTTGTGTTGCACGATGTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACTCTACTCTGCTCCACTCTACGAGGAAAAAGTCGCCCATC
  3   1   2      seed DMZ  5g3  out                        xl263c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGTTCCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTA
  5  -1   2       bld Lu1                    IMAGE:4056195-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCTGATCCTTCTCAGCGTGCCGCTGCTTGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACAGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCTTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGCAGAAAACATTATCTGCaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga15                               XL479l19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCGTGGATAATAAGCAAGAGATTTCAGAGGCCCAGCAGCTGATCACTATTTGTCGGGAATACATTGTTGGTCTGTCCATGGAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCCCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCNCAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTA
  3   1   2       add Emb9      in                    IMAGE:7975960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CANATAANNTTGTCCTAGCATCCAGAAGACAAAANNTACGAAAGCACTTTGAGCACACAAACGCATATTGAGATGCCGCCTATTCACACACTCCAGCCTGCAGACCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCTTAGAGCTCGGTCTCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAAATATGACATGCACAACCCCTTTGACATATGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCACTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTCTTCTCTGTAGTCATCGCTTGTGTTGCACGATGTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGATTAGCCACGCAAGAGACTAACCTTACACTGCTCTCGGCAACAGCTCANAAGAACCT
  3   1   2       bld Neu7      in                         XL012d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGTATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAATCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCAGTCTCTCAGCAAACAAGTTCAAATAAAG
  3   1   2       bld Neu7                                 XL025k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATAGATCGCAAGAAACTTCCGAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACGCTCNAGTCTCTCAGCAAACAAGTTCAAATAAAG
  5  -1   2       add Lu1                             IMAGE:4056195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGGACACCTAAAACGCTCTTTTATATGCCGCCTATTCACACATCCAACCTCAGCCCAGGCACATGATCTGGTACTGAGACCACCCGTCAACTTCTCTTCAAACTCAAGAATTCAAAACCGTGCTATTTTTGCCCGGCGACTCTTAGAGCTCGGTCCCAAGCCAAAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACAGACACCTATCAGCTCAANTATGACATGCACAACCCCTTCGATATTTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCTTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACAtttttccttttttCTGTAGTCAAGGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTTTAGTTTTTCAGCAAACAAGTTCAAATAAAGCAGAAAACCATTATTTGCaaaaaaaaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL465e13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTaaaaaaaaaa
  3   1   2       bld Tbd7      in                         XL101l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGAGATGGCCGCCTATTTCACACACTCCAGGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTTAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACAGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCGGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGG
  3   1   2       add Ga18      in                       xlk60n01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTATTTCACACACTCCAGCCTGCAGNCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAATCTCTTCTTCAAACTCAAGAATTTCAAANCCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGNTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATNNNNCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTNCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTNNNNNCAACGTGCGATCTNNNNGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCNANNNNNCANNAAANA
  5   1   2       bld Ga18      in                       xlk60n01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATTTCACACACTCCAGCCTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAATCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCNNNNNNCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGNAACTAACACTGCTCTAGTCTCTCAGCAAACAAGNTCNAATAAAGGTGAAAACATTaaaaaaaaaa
  3   1   2       bld Ga10 5g3  out                   IMAGE:3558257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCAGCCCGTGCACATGATTCTGGTACTGAGAACAGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTTTCTGCAAA
  3   1   2       bld Tbd7      in                         XL056b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTGCACATGATTCTGGTACTGAGAACANCCGTCAATCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATNATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAAC
  5   1   2       bld Ga15      in                       XL472d16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCGGAACAGCCGCTCAATCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL472d16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACAGCCGTCAATCTCTTCTTCAAACTCAAGAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAATTATGATATGCACAACCCCTTCGATATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCT
  3   1   2       bld Ga15                               XL505b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCNGTCAACCTCTTCTTCAAACTCAANAATTTCAAAACCGCTGCTACTTTTGCCCGGCGACTCCTAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTC
  3   1   2       bld Emb4                            IMAGE:4203343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAGAGCTCGGTCCCAAGCCAGAGGTTGCCCAACAGACCCGTAAAATAGTGTCCGCTTGTGAGAAGAACCTGGCGGACACCTATCAGCTCAATTATGATATGCACAATCCCTTCGATATGTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAATCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTATCTGCA
  3   1   2       add Ga15      in                       XL465e13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCGCTTGTGAGAAGAACNTGACGGACACCTATCAGCTCAACTANGACATGCACAACCCCTTGGACATGTGCGNTGCCTCNTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCTTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGNCAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCGGAGCTGCACANTTTTCCTTTTCTCTGTAGTCATTGCTTNGTGTTGCAGCGATTTAATCTCTCCTT
  5   1   2       bld Ga15      in                       XL435p20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCACGCGCTCCGTGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGTGAAAACATTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL435p20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACGGACACCTATCAGCTCAACTATGACATGCACAACCCCTTCGACATCTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAACGTGCGATCTGTGCGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCAGCGGGAAGAAACTAAC
  5   1   2       add Ga18      in                       xlk56c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACCCCTTCGACATCTGCGCTGNCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTGCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTGTGCNNNNNCNCATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTGCTCTAGTCTCTCAGCAAACAAGTTCAAATAAAGGNGAAAACATTaaaaaaaaaa
  3   1   2       add Ga18      in                       xlk56c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAACCCCTTCGACATCNGGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCTGTAGAGAAATGCCCATTGAGTGGAGCCTNCTACAGCCCTGAGTTCAAAGGACAAGTCTGTAGGGTCACAACAGTGACAGAAATCGGCAAGGATGTGATTGGGTTGAGGATCAGTCCTCTGCAGTTCCGTTAAGCACCAGCGTGTGACCTNNNGGAGCTGCACATTTTTCCTTTTCTCTGTAGTCATTGCTTGTGTTGCACGATTTAATCTCTCCTTCCGTGAAAGCTGGTCACAGTGTATGAGTGTATTAGCCACGGGAAGAAACTAACACTNCTCNNNNNNNCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)