Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk113n01ex.3                         6 END     5          13       83                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk113n01ex.3                         6 PI      94        697     1104                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012770293 Xl3.1-IMAGE:6947058.5 - 37 ESTs
                                                                       ..-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6947058.5                       CGTTGGCAGTAACAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCCCCCCCCCCTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTCTAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCG
                                                  Xl3.1-CHK-1012687438                             CAGTAACAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCCCCCCCCxxTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTxxxAxxATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCAT
                                                      consensus depths                            4     4     5     8    10    13    12    18    13    19    13    19    13    19    15    21    21    21    21    21    21    21    21    21    20    20    19    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    18    21    18    21    21    21    21    21    16    21    17    21    17    21    17    21    17    21    17    21    17    21    17    22    18    22    17    22    18    23    18    23    19    25    18    25    19    26    18    26    18    27    17    26    17    26    17    27    17    28    17    28    16    27    17    27    17    27    15    26    16    26    15    26    14    26    12    25    13    23     7    24    11    21    11    21    10    21    12    22    12    21    12    19    12    19    11    19    11    19    12    18    11    18    12    18    12    18    11    18    11    17    11    16    10    15    10    15    11    14    11    14    10    13    10    12    10    12     9    11     9    11     9    11     9    11     5    11     5    11     5    11     5    11     5    11     6    12     6    12     6    12     4    11     4    10     4     8
                                                                   VAR                                                           ATACAGCGACGGTTCCTATGTCCC
                                                                   SNP                                                                                                                                                                                                                                                                                                           ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----TT-----
                                               BLH ATG      50     179                       
                                               BLH MIN      35     109                       
                                               BLH MPR      32     109                       
                                               BLH OVR      50      67                       
                                               EST CLI      19      32                       
                                               ORF LNG      50       2                       
                                                                                                                                                                          PROTEIN --- Ci ==== 2e-042     NP_001027632.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN -== Ce ==== 3e-060     NP_502576.1 RAB family member (rab-19) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED = Cf ==== 3e-060     XP_539883.1 PREDICTED: similar to RAB19, member RAS oncogene family [Canis familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN === Dm ==== 3e-060     NP_523970.1 Rab-related protein 3 CG7062-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN === Ag ==== 1e-061     XP_308662.1 ENSANGP00000011129 [Anopheles gambiae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED - Bt ---- 2e-062     NP_001030212.1 hypothetical protein LOC506911 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - Sp ---- 3e-067     XP_001181901.1 PREDICTED: similar to RAB41 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PREDICTED - Dr ---= 6e-084     NP_001038812.1 hypothetical protein LOC751627 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Mm ---= 2e-092     NP_001034483.1 RAB43, member RAS oncogene family isoform a [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PREDICTED - Gg ---- 2e-094     XP_414313.1 PREDICTED: similar to Ras-related protein Rab [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN --- Hs ---- 2e-095     NP_940892.1 RAB41 protein [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Xt ==== 1e-105     CAJ82248.1 RAB43, member RAS oncogene family [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED = Xl ==== 1e-117     NP_001089457.1 hypothetical protein LOC734507 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6947058.5                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATGATG------------------------------------------------------------------------------------------TGA------------------------------------------------TAA---TGA---------------TAG---------------------------------------------TGA---------------------TGA---------------------------------TAG------------------------TGA---------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Neu7 5g3  in                         XL021l02.5p TGCAGGCAATTCGGCACGAGGGCGTTGGCAGTAATAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATTGAGACC
  5   1   2       bld Tbd7 5g3  in                         XL105f22.5p           GGGCTACTTCCGCGTTGGCAGTAACAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACA
  5   1   2       bld Tbd7 5g3  in                         XL075j06.5p                 CTTCCGCGTTGGCAGTAACAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTGCAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCAGAGACTTTGGCGCGACATTTCGA
  5   1   2       bld Neu7 5g3  in                         XL021p23.5p                     GGCGTTGGCAGTAATAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATTGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGA
  5   1   2       bld Kid  5x3                        IMAGE:7009364.5p                        CCCACGCGTCCGAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGAACGTGGGGGAGGCGTGGGGCTGCGGCCGCTGACGGTAACTTCCCCTCTCTCGTTTTCACTTTTTGGGGCCCCTCGTGGTCTGCTGGTAATTGTGA
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075131.5p                           GGCAGTAACAGGAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAAAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCTCCCCCTC
  5   1   2      seed Ga15 5x3                           XL440i04ex.5p                                 AAGAGAAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCCCCCTGTATCACACTT
  5   1   2       bld FaB  5x3                        IMAGE:8071765.5p                                   GAGAAGGCGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGNGGCTGCGGCTGCTGACGGTAccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCT
  5   1   2       bld Emb3 5g3  in                    IMAGE:3398965.5p                                          CGGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCTGGCTCCAACATTGTCCAGCTGCTGATGGGAAACAAGTCCGACCTCCACGAGTCTGGGAAGGTGCAGCTGCAGGATGCGGAGACTTTGGCGCGA
  5   1   2       bld Ga18 5g3  in                      xlk127k19ex.5p                                          AGGNGGAGGAGNAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGCCCCCGACGAGCTCNNNNNTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGNCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGNNAGGAGNGATTTCNNACCATCACGCAGAGTTACTACCGCAGCNNAAATGNNNNNTCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGNGCAGCTGCGGGAGNNGGNNNNNTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGNNCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGNNGTGGGGGAGGCGNGGGGCTGCNG
  5   1   2       bld Eye1 5x3                        IMAGE:6947058.5p                                           GGAGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGTGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTAccccccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGGTCCCCTCTGCTTAGTAGCTGAATTCCACGCAATGCCCTTATCCTGGATACTGGGGGCCCCCGGTTACACTGCACATTCCCTTTAAGGGGGCGGGGG
  5   1   2       bld Ga18      out                     xlk113n01ex.5p                                            GNGAGGGAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGCCCCCGNCGAGCnnnnnnnnTCCTCTTCAAGTTGATTCTCATCGGGGANGCGGGGGTGGGAAAGACGTGTGTGGTG
  5   1   2       bld Ga18 5g3  out                     xlk161o07ex.5p                                             CGGAGGANNAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGCCCCCGACGAGCTNNNNNNTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGNNTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGNCAGGAGCGATTTCNNACCATCACGCAGAGTTACTACCGCAGCGNAAATGNNNNNTCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGNNGGNNNNNTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGNGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGNCGTGGGGGAGGNGTGGGGNTGCG
  5   1   2       bld Ga18 5g3  out                     xlk152p12ex.5p                                                  GNNNAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGCCCCCGACGAGCTCTGNNNTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGNCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGNCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGNAAATNNNNNNTCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGNGGNNNNNTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGNNCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGNCGTGGGGGAGGCGTGGGGCTGCGGNTNNTGACGGTACCTcccccccccccccccc
  5   1   2      shim Ga18 5g3  out                     xlk102m19ex.5p                                                   GAGCAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGCCCCCGACGAGCTCNNNNTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGNCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGNNAGGAGCGATTTCNNACCATCACGCAGAGTTACTACCGCAGCGNAAATGNNNNNTCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGNGCAGCTGCGGGAGGNGGNNNNNTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGNGNTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGNNCGTGGGGNNNGCGTGGGGCTGCGNNTNNTGACGG
  5   1   2       bld Te2N 5x3                        IMAGE:7204648.5p                                                     ATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGTGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTAcccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGNTATTGTGACTCAGTAGTGACTTTTAGTCTCTGAACATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCCCGCAATGCCTTATCCTGGATACTGGGGCCCCCCGTTACACTGCACATTCCTTTTAGGTGCCGGGGGGCCCCTGCCCGTTTTTATGAAAATGACCCAAAAAGGCCN
  5   1   2       bld Te2N 5x3                        IMAGE:7206768.5p                                                     ATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGTGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGNGGCTGCGGCTGCTGACGGTAcccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTTCA
  5   1   2       bld Ga18 5g3  out                     xlk106m21ex.5p                                                     AGNAGATGATACAGCGACGGTTCCTATGTCCCTCCCCTCCGNCCCCGACGAGCTNNNNNTTCCTCTTCNAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGANGTGTGTGGTACAGCGCTTCCGTAGCGGAGNCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGNNAGGAGNGATTTCGCACCATCACGCAGAGTTACTACCGCAGCNNAAATGGNNNCATCATCGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGNGCAGCTGCGGGAGGNGGNNNNNTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGNGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGNCCCGTCTTCTCCGAGAAANCGTCCGACAGCATCAAGTTGGNCAGCACNNNGTNGGGGAGGCGTGGGGCTGCGNNT
  5   1   2       bld DMZ  5g3  in                         xl332c21.5p                                                               GACGGTTCCTATGTCCCTCCCCTCCGGGCCCCCGGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAAAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCTccccctcccccccGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTC
  5   1   2       bld Em10                            IMAGE:7980022.5p                                                                                                GGACGAGCTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACCATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAAAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGNGGCTGCGGCTGCTGACGGTACCTcccctcccccccGTATCACACTTTAGGGGCCCAATTGTCTGCTGTATTGTGACTCGTAGTGACTTTAGCTCTGACATCGGGGAAAGGCCGTCCTCTGCTTATACTGATTCACGCATGCTATCTGATACGGGGCCCGTACCGCACTCCTTAGGCGGGGCTGCATTTTAATACCAAAGCAGGTGCGGACGTCTCTCGGGCATCCTGA
  5   1   2       bld Emb3                   IMAGE:3398965-IMAGp.IMAGp                                                                                                       CTCTGCGATTTCCTCTTCAAGTTGATTCTCATCGGGGATGCGGGGGTGGGAAAGACGTGTGTGGTACAGCGCTTCCGTAGCGGAGTCTTCGCCGAGCGTCAGGGCAGCACCATCGGGGTGGATTTTACTATGAAAACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTAcccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCCGTCCCTCCTGCTTAGTAGCTGAATTTCCACGCAATGCCTTATCCTGATTACTGGGGGCCCCCGTTACACTGCCACATTCCCTTTAAGTGC
  5   1   2       bld FaBN                            IMAGE:8078952.5p                                                                                                                                                                                                                                              ACCCTCGAGATCCAGGGGAAGAGGGTCAAGTTGCAGATCTGGGACACGGCGGGGCAGGAGCGATTTCGCACGATCACGCAGAGTTACTACCGCAGCGCAAATGGCGCCATCATTGCCTATGACATCACCAAGAGGAAATCGTTTGCGTCAGTTCCGCGCTGGATTGAGGATGTGAAGAAATACGCCGGCTCCAACATTGTCCAGCTGCTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTAccccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTT
  3   1   2       bld DMZ  5g3  in                         xl332c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                AATACGCCGGNTCCAACATTGTCCAGCTGNTGATTGGAAACAAGTCCGACCTCCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCGGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAAAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCTCCCCCTCCCCCCCGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCGTGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATTGCTTCTTGCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAA
  5   1   2       bld Ga12      in                         XL170i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAANAGTCCGACCTCACGAGTCGCGGGAGGTGCAGCTGCGGGAGGCAGAGACTTTGGCGCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTAcccccccccTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCANAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGT
  3   1   2       bld DMZ                                 rxl326i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGTCGCGGGAGGTGCAGCTGCGGGAGGCAGAGACTTTGGCGNGACATTTNGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAGGAGAGGATGGGAAAATAAAGAAGAAAAGGAGAAAAAGGAAAAAAAAAGAGAGGAAGAAAAGTAGAAAAATAAGGAATAGGAAAAGATAAAGAGAAAAAGAAAGGAAAGTAAATGAAAAGTAAGAATGATATAGAATGAAAAAGGTGTGAAATGGAAAGAGTTAAAAGAAGTGGAAAGAAAGAAGAGAAAGGGAGAGAAAAAGAGAAAAAGAAAAAAAAGAAACCTCCCCCTCCCCCCCGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATTGTGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTACTAATAATCCTTATATATTGCTTCTTGCCTTTTTATTAAACAGCGTCGCCTTNCCCAGCAGAAACNAGG
  3   1   2       add Te2N                            IMAGE:7764070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTTTGCCGATACATTTCGACATTTCGTGAACCATCGAGACCTCGCCCAAAGACTCCAGTAACGTGGAGGAGGCATTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCACTGTCTTCTCTGAGAAATCGTCCGACAGCATCAATTTGGACAGCACGGTCGTGGGGGAGGCGTGAGGCTATGCATACTGACGGTACCTCCCCCCCCCCGTATCACACTTTAGGGGCCCCAATTTTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGATGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCGGTTTTATGAAATTACCCAGAAGCCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGTTGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATCGCTTCTTCCCTTTTTATTAAACAGACGTCGCCTTTTCCCAGCCAGGAAATCTATATTTATCACCATGCGATTCATTGGAATAAATAATGCAGTGCAGAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7 5g3  in                         XL021p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACATTTCGACATTCCGTGCGCCATTGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGNAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCTCCCCCCCTCCCCTGTATTACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCGGTTTTATGAAATTACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGTTGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATCGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCATNGNAATAAA
  3   1   2       bld Tbd7 5g3  in                         XL075j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGACATTTCGACATTCCGTGCGCCATCGAGACCTCGGCCAAAGACTCCAGTAACGTGGAGGAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATNGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTNCGGCTGCTGACGGTACCCCCCCCCTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACNAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTACCCAG
  3   1   2       add Ga18 5g3  in                      xlk127k19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTNCGNNNTNCNGTGCGCCATNNNNNCCTCGGCCNAAAGACTCCAGTNNCGTGGAGGAGNCNTTTGAGAAAATGNCCACGGAGCNGATGATGCNCCACGGGGNCCCCNTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGNGGAGNCGTGGGNCTGCGNCTGCTGACGGTNCCCCCCCCCCTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGNTGNNNNNNNCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCNNTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAANANNNNNNNTTTCCCAGCAGGAANCTATNTNNNNNCCA
  3   1   2       bld Neu7 5g3  in                         XL021l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCAGTAACGTGNAGNAGGCGTTTGAGAAAATGGCCACGGAGCTGATGATGCGCCACGGGGGCCCCGTCTTCTCCGAGAAATCGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGCTGACGGTACCTCCCCCCTCCCCTGTATTACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCGGTTTTATGAAATTACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGTTGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATCGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATNCATNGGAATAAATA
  3   1   2       bld Ga12      in                         XL170i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAGGNGTTTGAGAAAATGGCCNNGGAGNTGATGATGNGCCACGGGGGCCCCGTTTTTTCCGAGAAATTGTCCGACAGCATCAAGTTGGACAGCACGGACGTGGGGGAGGCGTGGGGCTGCGGCTGNTGACGGTACCCCCCCCCTGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCA
  3   1   2       add DMZ                                 rxl249c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATNAAGTTGGNCANCANGGACGNGGGGGAGGNGTGGGGCTGCGGCTNCTGACGGTACCCCCCCCCCTGTATCACACTTTAGGGGCCCCAATTGTCTGNNGTAATTGTGACTCAGTAGTGACTTTTAGTCTGTGACAATCGCGGGAAAGGGCCCGTCCNTCNTGNTTAGTAGNTGAATTNCACGCAATGCNTTATCCNGATTANTGGGGCCCCCGTTACACTGCACATTCNTTTAGGTGCCGGGGGCCNTGCCGGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTT
  5   1   2       bld Kid                             IMAGE:7011619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGCGTCCGGCTGACGGTACCTccccccccccGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCTGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCATTGGAATAAATAATCAGTGCAGAAATGTCTCTGGCTCTAATGTGTGGCCCCAGCACTACCCCCACTCACAGTAAAGAACCCCTCCCTATGCTGATGGTGAGATCTCCTTTCCTCCCCACCAATGAATCACTCATTCTCCTCTCTTGGTAGGGAATCCCATAACCTGACTGTCCTTACAGTAAAGAACCCCTTCCTATGCTGATGGTGAGATCTCCTTTCCTCCCCACAATGAATCACTCATTCCCCC
  3   1   2       bld Tbd7 5g3  in                         XL105f22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCCCCCCGTATCACACTTTAGGGGCCCCAATTGTCTGCTGTAATTGAGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATTGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCATNGNAATAAA
  3   1   2       bld Emb3 5g3  in                    IMAGE:3398965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTAATTGTGACTCAGTAGTGACTTTTAGTCTCTGACAATCGCGGGAAAGGGCCCGTCCCTCCTGCTTAGTAGCTGAATTCCACGCAATGCCTTATCCTGATTACTGGGGCCCCCGTTACACTGCACATTCCTTTAGGTGCCGGGGGCCCTGCCAGTTTTATGAAATGACCCAGAAGGCCGAGGGGTGGCCGTGATACTGTTCTCCCTCCCGGGGTCAGTTCTCCTGGAGTCTCATTCCATTTCAGTCCTGTAGCCCCAGATCATTCCCAGATGCACCTCATCATGTGACTCTGCCAGGACCAAACCACGAGAAAGTGCAATGACCTCAACATGCAGATTTACTAATAATCCTTATATATCGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCATTGGAATAAATAATCAGTGCAGAAAAAAAAAAAAA
  5   1   0       add Ga15                               XL410i17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCGCTTATATATCGCTTCTTCCCTTTTTATTAAACAGCGTCGCCTTTTCCCAGCAGGAAACTATATTTATCACCAGCGATTCATTGGAATAAATAATCAGTGCAGaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)