Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:6874551.3                      19 END     6          11       31                (no blast hit)
     2   1.0    0Xl3.1-XL161n12.3                           10 END     5           9       50                (no blast hit)
     3   2.0    0Xl3.1-xl280b04.5                           10 END     1           1       10                hypothetical protein LOC443577 [Xenopus laevis]
     4   1.0    0Xl3.1-xlk70i03ex.3                          6 END     1           1       16                hypothetical protein LOC100145732 [Xenopus tropicalis]
     5   2.0    0Xl3.1-IMAGE:6864896.5                       3 END     1           1       33                hypothetical protein LOC443577 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     6   0.0    0Xl3.1-IMAGE:6864896.5                       3 PI      92          1      309                hypothetical protein LOC443577 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012770849 Xl3.1-XL205l17.3 - 51 ESTs
                                                                       ......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL205l17.3                                                                                                 CCAAAATCCATTTCAGAAAAAGGCTCAGAGGAAGATGATGAAAAGCTTGATTATGATGACAAATCTGAGGAGTCCTCCCAGGCAGAAGTGGGTATTACATCTCAGGATAAGAACTTTGATGAAGAAAGCAATGCTTCCTTGAGTACTGCCCGTGATGAAACCCGAGATGGATTCTTTTTGGAGGATGGAGAACAATCTGGGTTGCATATGCTTCGTGAGAGGACCTTCTCTTTCTCTTTCTGGCCCAAGGACCGTGTAATGATCAACCGATTAGACAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAACAATCTGGTTTCGTACCAGAGTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAACAATGGCTCCAGGCCTGTTCTACTCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTAGTGCTGTTAGCAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTAA
                                                  Xl3.1-CHK-1012686653                                                                                                       TCCATTTCAGAAAAAGGCTCAGAGGAAGATGATGAAAAGCTTGATTATGATGACAAATCTGAGGAGTCCTCCCAGGCAGAAGTGGGTATTACATCTCAGGATAAGAACTTTGATGAAGAAAGCAATGCTTCCTTGAGTACTGCCCGTGATGAAACCCGAGATGGATTTTTTTTGGAGGATGGAGAACAATCTGGGTTGCATATGCTTCGTGAGAGGACCTTCTCTTTCTCTTTCTGGCCCAAGGACCGTGTAATGATCAACCGATTAGACAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCxGAxTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCxxCxCxACAATGGCTCCAGGCCTGTxCxxxTCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTxxTGxTxxxxxxAGTGAAGAAxAxxxxGCxGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTAAAAAAAA
                                                      consensus depths                                                                                                      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8    10    10     8    10    10    10     9    10    10    10     9    10    10    10    10    10     9    10    10    10    10    10     9    10    10    10    10    10     9    10     8     9     8     9     8     9     8     9     7     8     7     7     8     8     7     7     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     7     8     8     9     9    10     9    11     9    11     9    11    11    11     9    10     9    10     9     9     9     9     9    10     9    10     9    10    10    10     9    10     9    10     9    10     9    10     9    10     7     9     7     9     8    11     9    11     9    10    10    12     9    12    11    12    11    12    10    12    12    13    12    13    13    13    13    13    13    13    13    13    14    14    14    14    14    15    14    15    15    16    16    16    17    17    16    16    16    16    15    17    16    18    16    19    17    20    19    20    18    21    11    20    12    22    12    24    12    24    12    25    12    26    12    24    12    24    13    26    13    26    12    26    13    27    12    26    13    27    13    27    13    25    12    25    13    25    13    25    13    25    13    25    13    25    13    25    13    26    13    25    13    25    13    25    12    24    11    24    11    23    11    23    11    23    11    23    11    23    11    23    11    23    11    23    10    23    10    22    10    22    11    23    11    23    11    23    11    23    11    23    11    22    11    22    11    22    10    21    10    22    10    22    10    21    10    21    10    20    10    20    11    20    11    19    10    19     9    18     7    14     6    11     5     7     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCTCCAGGCCTGTTCTACCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTTAGCTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T-------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C-A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------G--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------CT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------G---
  5   1   2       add Emb1                            IMAGE:6632611.5p GAACAAGCAGCAGACACTGCTGAAAAGCCTGTAAAACAGGAAAGTGATCCAGAGGCCATTGCTATTAACGATGAAATTAAAATAGCAGAAGAGGCTCCAAAATCCATTTCAGAAAAAGGCTCAGAGGAAGATGATGAAAAGCTTGATTATGATGACAAATCTGAGGAGTCCTCCCAGGCAGAAGTGGGTATTACATCTCAGGATAAGAACTTTGATGAAGAAAGCAATGCTTCCTTGAGTACTGCCCGTGATGAAACCCGAGATGGAttttttttGGAGGATGGAGAACAATCTGGGCTGCATATGCTTCGTGAGAGGACCTTCTCTTTCTCTTTCTGGCCCAAGGACCGTGTAATGATCAACCGATTAGACAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGANGCAGAGCGGGCTGCTAAGAGAAGGGAATCTATGGAGATGGTGGCTCAGCTGAGAAGATCTCAAATGGGAGCAGAANATGGACAAGANNAAAGTGTAGATTTATCANATGCCCTCAGGGNAGGCTACAGTTCTACCTCCAGTTTTCCATCTCTTACGTCCTCAATTTCTGTTAAAATAATTCATCCAACCCCAAGTCTCAGGATGCCTTTTAAAACTCCAAATGGAGN
  5   1   2       bld Ga15                               XL438a10ex.5p                                                                                                 CCAAAATCCATTTCAGAAAAAGGCTCAGAGGAAGATGATGAAAAGCTTGATTATGATGACAAATCTGAGGAGTCCTCCCAGGCAGAAGTGGGTATTACATCTCAGGATAAGAACTTTGATGAAGAAAGCAATGCTTCCTTGAGTACTGCCCGTGATGAAACCCGAGATGGATTCTTTTTGGAGGATGGAGAACAATCTGGGTTGCATATGCTTCGTGAGAGGACCTTCTCTTTCTCTTTCTGGCCCAAGGACCGTGTAATGATCAACCGATTAGACAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAG
  5   1   2       add Ga12                                 XL164p21.5p                                                                                                                                                                                                                               GGCAATGCTTCCTTGAGTACTGCCCGTGATGAAACCAGAGATGGATTCTTTTTGGAGGATGGAGACCAATCTGGGTTGCATATGCTTCGTGAGAGGACCTTCTCTTTCTCTTTCTGGCCCAAGGACCGTGTAATTATCAACCGATTAGACAACATCTGTGAAGCTGTGCTGAAAGGAAAGTGGCCAGTAAACAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGGTACACACCAACTGCTGTGGACAGCCCCTTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAACTATAGCGGCAGTGAAGACATAAGTGCTTCACCGCAACTCTCCCAGGAAACTTCACTGAGTTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGCGCTGCCAAGAGAAGGAATCTTATGGAGATGGTAGCTCAGCTGAGAGGGTCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGTTACAAGTTCTACCTCAAGTTTTCCATCTCTTACTTCTCAATTTCTGTTAAAT
  5   1   2       bld Ga12      in                         XL178n21.5p                                                                                                                                                                                                                                                                                                                                                            ACCGTGTAATGATNACCGATTAGACAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGA
  5   1   2       add Ooc3                            IMAGE:3436746.5p                                                                                                                                                                                                                                                                                                                                                                      TCAACCGATTAGACAACATCTGTGAAGCTGTGCTGAAAGGAAAGTGGCCAGTAAACAGACGGCAGTATGTTTGACTTCCCAGGACTCCTCCCTGGGTACACACCAACTGCTGTGGACAGCCCCTTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAACTATAGCGGCAGTGAAGACATAAGTGCTTCACCGCAACTCTCCCAGGAAACTTCACTGAGTTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGCGCTGCCAAGAGAAGGAATCTTATGGAGATGGTAGCTCAGCTGAGAGGGTCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGTTACAAGTTCTACCTCAAGTTCTCCATCTCTTACTTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCTGATGCCTTTAAAACTCATATGGAGCGACTGCATGTAGGTCTTTCATGCACACCTAC
  5   1   2       bld Ga15      out                      XL463c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                    CAACATCTGTGAAACTGTGCTGAAAGGAAAGTGGCCAGTAAATAGACGGCAGATGTTTGACTTCCCAGGACTCCTCCCTGGCTACACACCAACTGCTGTGGACAGCCCATTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAGCTATAGTGGCAGTGAAGACATTAGTGCTTCACCGCAAGTCTCCCAGGAAACTGCACTGAGCTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAAACATTCCATCTCCTGGACAGCTGGAGCC
  5   1   2       bld DMZ       ?                          xl312e13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCCTTGCAAAAGAGAAGCTTTGCTGAGCTCTCCATGGTGGCTCAGGGCAACTATAGCGGCAGTGAAGACATAAGTGCTTCACCGCAACTCTCCCAGGAAACTTCACTGAGTTTATCTGTGCCACGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGCGCTGCCAAGAGAAGGAATCTTATGGAGATGGTAGCTCAGCTGAGAGGGTCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGTTACAAGTTCTACCTCAAGTTTTCCATCTCTTACTTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCTGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTGCTCAATGGCTCTTTAATTGATGGAGAACCTCCCATGAAAAGGCGAAGAGGAAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGACTTCATCATCTGTGGATGAGACTGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCGCCAACTAGAAACATTCCATCTCCTGGACAGTTGGAGCCGGAGACCCGTATCCCTGTCATTAACCTGGAAGATGGGGCCAGGCTTGCAGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTACATCCTACGTACA
  5   1   2       bld Ga12      in                         XL169j03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTGAGCTTATCTGTGCCCGTCAGCGAAGACGAAGGAGAAGGAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCAT
  5   1   2       bld DMZ       out                        xl301j24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGATTGAGGTTGAGGCANAGCGGGCTGCTAAGAGAAGGANTCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCANTGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAA
  5   1   2       bld DMZ                                  xl300j24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGATTGAGGTTGAGGCAGAGCGGGCTGCTAAGAGAAGGAATCTTATGGAGATGGTGGCTCAGCTGAGAGGATCTCAAATGGGAGCAGAAAATGGACAAGAAAAAGTTGTAGATTTATCAAATGCCTCCAGGGAGGCTACAAGTTCTACCTCAAGTTTTCCATCTCTTACGTCTCAATTTCTGTTAAATAATTCATCCACCCCAGTCTCAGATGCCTTTAAAACTCAAATGGAGCGACTGCAGGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAACTGCAGATATGTTGTTCTCTCACTTTCAAAAGCCTAAACAGAAGCGACA
  5   1   2       bld DMZ       in                         xl306i24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGGTCTTTCATGCACACCTACAAGGCATCTACTCAATGGCTCTTTAATTGACGGTGAACCCCCCATGAAAAGGCGAAGAGGGAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTCAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAG
  5   1   2       bld Tbd7 5g                              XL098e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNCATCTGCTCAATGGCTCTTTAATTGATGGAGAACCTCCCATGAAAAGGCGAAGAGGAAGAAGGAAAAATGTTGAAGGCCTAGATCTTTTGTTTATGAGTAACAAAAGGACTTCATCATCTGTGGATGAGACTGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCCGCCAACTAGAAACATTCCATCTCCTGGACAGTTGGAGCCGGAGACCCGTATCCCTGTCATTAACCTGGAAGATGGGGCCAGGCTTGCAGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTACATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACCGATGTCGAAATCCAAACAAATTGGACATTAACACGCTGACAGGAGATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTA
  5   1   2       bld Ga15      in                       XL436k14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGGACTTCATCATCTGTGGATGAGACTGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCGCCAACTAGAAACATTCCATCTCCTGGACAGTTGGAGCCGGAGACCCGTATCCCTGTCATTAACCTGGAAGATGGGGCCAGGCTTGCAGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTACATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACCGATGTCGAAATCCAAACAAATTGGACATTAACACGCTGACAGGAGATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCC
  5   1   2       bld DMZ       out                        xl300j10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTTCATTATCTGTGGATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTCAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATG
  5   1   2       bld DMZ       in                         xl230g01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGACACCGATGTGACCAAAGCCTATGATGAAGATATAGAAACACCACCAACTAGAAACATTCCATCTCCTGGACAGCTGGAGCCGGAGACCCGTATCCCTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTCAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCNACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGG
  5   1   2       bld Neu7 5g                              XL031c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGACCAAGCCTATGATGAAGATATAGCAAACACCGCCAACTAGAAACATTCCATCTCCTGGACAGTTGGAGCCGGAGACCCGTATCCCTGTCATTAACCTGGAAGATGGGGCCAGGCTTGCAGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTACATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACCGATGTCGAAATCCAAACAAATTGGACATTAACACGCTGACAGGAGATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGA
  5   1   2       bld Brn3                            IMAGE:8537453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTCATTAACTTGGACGATGGGACCAGGCTTGTTGGGGAAGAAGCCCCCAAAAACAAAGATCTAGTTGAATGGTTAAAGTTGCATCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTCAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTATGGGGTTTCCCCCTGNGCTTGCAGCAGCTGCTGCCGCTGGANGTGAATCTAAAATCCTGCTGCATGTTGCCTCTATGCTGCAGGCATGGCGGGATGCCAANCTGTTTGGCTTGGTGGACTTTGAATACCCCTACAGCGGCAAAGTAATTCCTACACTTCATCAAGAGAACGAGATGCACTCAAGCTATAAAAGATGAATGAGAGAGCTAGATCAACACAATTGTCTCTCGCTTGTCTTGGC
  5   1   2       bld Tbd7 5g3  out                        XL107e17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTACGTACACTGTTGATATGCCAAGTTATGTACCAAAGACTGCAGATATGTTGTTCTCTCACTTTGAAAAGCCTAAACAGAAGCGACACCGATGTCGAAATCCAAACAAATTGGACATTAACACGCTGACAGGAGATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGAAGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTC
  5   1   2       bld DMZ                                  xl272i11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGTTCTCTCACTTTCAAAAGCCTAAACAGAAGCGACACAGGTGTCGAAATCCTAACAAGTTGGACATTAACACACTGACAGGAGATGAACGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGA
  5   1   2       bld Tbd7      out                        XL076h16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCACTTTGNAAAAGCCTAAACAGCAAGCGACACCGTATGTCGTAAATCCAAACAAATTGGACATTAACACGCTGNCAGGNAGNATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGNAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGNTGAATAGTTTATTNGCTGGANTGGNTCTTGCTNGC
  3   1   2       bld Bla1                            IMAGE:3380781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGTGTCGAAATCCTAACAAGTTGTACATTAACACACTGACAGTAGATGGACGTGTGCCTGTGGTGAACGGACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGTCCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGTCTGGTCAGATATGGTAAAGCGATCTGGTTTCGTACCAGAGTCGATGTTTGATGGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGTTAGCAGGAGAGGAAGAAGGCCAGAAAGTGAGATTGCCAAAGCAGTTGCAGGTGCTGTAG
  5   1   2       bld Egg6                   IMAGE:4434730-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGTAGTAAGGCGACAAATTGGACATTAACACGCTGACAGGAGATGAAAGGGTGCCTGTGGTGAACAAACGCAATGGGAAAAAAATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAATCCAGAATTTGCGGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGTTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGATAAACTGAGGATGGCACTTCGAAGGCTGACGAGAAGAAGACAGAAAC
  5   1   2       bld Ga15                               XL403i23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGTGAACAAACGCAATGGGAAAAAGATGGGAGGAGCCATGGCACCACCTATGAGAGACCTTCCACGATGGCTGGAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCNAATCCTCTGGC
  5   1   2      seed Ga15                               XL409e11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGAAAACCCCGAATTTGGGGTTAGTCCAGACTGGACAGATATCGTAAAGCAATCTGGTTTCGTACCAGAGTCGATGTTTGATCGTCTTCTTACTGGGCCTGTAGTAAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCANAGTGCTGTTA
  5   1   2       chi Em10                            IMAGE:8317814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTTGCTCCAGACTGGACTGATATCGTAAAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTATAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGTTGGAATGGATCTTGCTAGCCATCATAATCTCCAAAATCTACAGTCTCTCCAAATTGCTGGTATAATGGGGTTTCCCCATGGGCTTGTAATATCTGCTGCCTTTGGAAGTATATCTTAAAATGCGGCTGCAACGTATTTTTTTAATGCTGCCAGGAATGACTGGATTGAAAATTAAGGATGGGCTTTGTTTGACATTTATATATTCTATATTGCAGTAGCATATGTAAATATTAAAATAAATTCTGACTAATATATATACTTGATAGAAGTATATTCTAGTGACGCTTATAATCAGAATGTTACTGGACTAGatatatatatatTGTATCAACTAAGTGACCGTATTCTGCTAATGGTGTTTATAATCGATTGATAGATAAAATGATATTATATGTTAAATGTTACAATGTGtttttttttAATTATATTTAAAACTTATTGAATGTAATCATGTTTGATCTATTATACAATTTAATTTTACTATATA
  5   1   2       bld Emb9      out                   IMAGE:7973922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACAATCTGGTTTCGTACCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCATGTTTCTACGCCTGGTTTAGGAGATTGACCTACCGGTTTCCCTCATAGCTGAACTCGAGTGCGTAACTTAGCAAGAAAGCTGCGACACGTNAATCAGACGACGACCAAGAAGCTGATAACGCCATCCTTTTGAAATAACGCAGAGAAAGATCCAATGGAATATGAATAACaaaaaaaaaTATAGTTCATTTAGGTACCGTACCG
  5   1   2       bld Ga15                               XL414f16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGATTCAATGTTTGATCGTCTTCTTACTGGGCCTGTAATTAGAGAAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCCAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTANGAGGATTGACACTACCGGGTTTCCCATCACTANCTGGACTTCANAGTGCTGTTANCTCTANCGAAGAAAAGGCTGCTGACNACTGTGANAATC
  3   1   2       chi DMZ       out                        xl280b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAAATTACATGGTGCGAGGAGATTTTTCNATGCAACAACATGGTTCCACTACCGTCACAAAGGATGAATCAGTTTTCACAAGGGCAAGATGGTCTTAATCAGGGAAATCCGTTCCTTGGTGCTGCAGGACCAGGTCATTTATCACATGTGCCCCAGCAAAATCCTAACATGGGAGCTTCTCTACGTCATACAGTACAACAATTTCATCATCATCCCCCCACTACTCTCCATGGAGAATCCGTTGCTCACAGTCCTGGATTTTCTCCTAATCCTTCTCAGCAGGGTGCAGTGAGGCCACAGTCCCTTAATTTTAATTCTCGTAACCAGACTGTACCTTCACCCACGTTAAACAACTCAGGGCAGTATTCCCGCTATCCTTATAGTAACCTTAATCAGGGATTAGTTAATAATACAGGGATGAATCAGAACTTAGGCCTTACAAACAACACTCCAATGACTCCCTCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAATAGCCAAGGACTGATGCACCAGCAAACTATTCATCCTAGTGGCTCACTTAACCAAATGAACACACAAACTATGCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGG
  3   1   2       bld Ga15                               XL485o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAGAAGAAGGGGGCTAGCAGGAGAGGAAGAAGGCCCCAAAAAGTGAAAATTGCCAAAGCAGCTGCAGCTGCTGCTGCTGTAGCCTCGACATCTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGAAGA
  5   1   2       bld Tad2      out                   IMAGE:6874551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGGGGCTAGCAGGAGAGGAAGAAGGCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGTATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGGTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAAGCTGCCGGACGACGGGGGAGAATCCGGAAACCAGCGGACCCAAAGGGAGAA
  3   1   2       bld Ga12      out                        XL205l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGAGAGGAAGAAGNCCAAAAAGTGAAATTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAACTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAGACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGAGAATGGACAAG
  3   1   2       bld DMZ       in                         xl230g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGGCCAAAAAGTGAANTTGCCAAAGCAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAACTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAGACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCC
  3   1   2       bld DMZ       in                         xl306i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTGCAGCTGCTGTAGCCTCGACATCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAG
  5  -1   2       bld Bla2                            IMAGE:7298034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAAGCAGTGAGTGCGTAGCTGACATTGGATGACCATGCTGATGATGCNTATTGCTGAATGATCTGCTAGCCTCAAATCTCCAGATCTGCAGCTCTCCAACTGCTGGCCTATGGGGTTCCCCCTGGGCTGCAGCAGCTGTGCCGCTGGAGGGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAACTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCGTACCCATTCGCCTAAGATTG
  3   1   2       bld Ga12      in                         XL169j03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGGAATGAACCCATTGCTGATGAATAGCCTATTTGCTGGAATGGATCTTGCTAGCCTTCAAAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAACTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAGACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATGGACAAG
  5   1   2       bld DMZ       out                        xl297k16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCANAGGAGAGCATGGATAAAACGGCCGATTCATCTAT
  5   1   2       bld DMZ       out                        xl253j06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGAATCAACCCATTGCTGATGAATAGTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGC
  5   1   2       bld FaB                             IMAGE:8071664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTATTTGCTGGAATGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGATGAATTGGACAATGAAACCGATAATAAAATAAAAATACAGTTAAAT
  3   1   2       bld Neu7      out                        XL034k23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGATCTTGCTAGCCTTCAGAATCTCCAGAATCTGCAGTCTCTCCAACTTGCTGGTCTAATGGGGTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCC
  5   1   2       bld Ga15                               XL430m14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTCTCTCCAACTTGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL178n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCAACTTGCTGGCNTAATGGGGTTTCCCCNTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAAGGNTCAAGGAGAAGAAGGGGAGTCCCCAG
  5   1   2       bld Ga15      out                      XL439h10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGGCCTAATGGGGTTTCCCCCTGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATCCTGCTGCCATGTTGCCTCTAATGCTGCCAGGCATGGCGGGATTGCCAAACCTGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAACAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACGGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACTGAAACTGAAGAGGATGCTAAAGACTCTGACAAAACAGATACTGTTTCTGCTACTGACTCTGGATCTGTTGGTGCTGCTGCTACTACCACAGCTGGATTGTCTGCCAATCCTCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCTCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGTGAAGAAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTaaaaaaaaaa
  3   1   2       bld Tbd7                                 XL080i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTCCCCATGGGCTTGCAGCAGCTGCTGCCGCTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGAT
  3  -1   2       bld Tbd4                            IMAGE:4060363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCACTGGAGGTGATTCTAAAAATGCTGCTGCCATGCTGCCTTTAATGCTGCCCGGCATGGCGGGATTGCCGAACATGTTTGGGCTTGGTGGACTTTTGAATAACCCCTTAGCAGCTGGCAGCAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGATGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGTTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAAGAGAAGAAGGGGAGTCCCCAGATGGGGAA
  3   1   2       bld Ga15      in                       XL436k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTAATTCCACTACAGCTTCCAGTCAAGGAGAAACTGAGGANGGCACTTCGAAGGCTGATGAGAAGAAGACAGAAACTGAAGAGGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTATTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGTCCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGATGAAT
  5   1   2       bld Egg1                               PBX0059C08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGATGAGAAGAACACAGAAACTGAAGACGATGCTAAAGACTCTGAGAAAACAGATACTGTTTCTGCTACTGAAGCTGGATCTGGTGGTGCTGCTACTACCACAGCTGGATTGTCTGCGAATGCGCTGGCCTTCAGACCCTTCCTACTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTATGAGGATTGACACTACCGGGTTTCCCATGACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACT
  3   1   2       bld Tbd7                                 XL108e13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTCCACAATGGCTCCAGGCCTGTTCTACCCATCCATGTTTCTACCGCCTGGTTTAGGAGGATTGACACTACCGGGTTTCCCATCACTAGCTGGACTTCAGAGTGCTGTTAGCTCTAGCGAAGAAAAGGCTGCTGACGACTGTGAGAATCAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGAAG
  5   1   2       bld Tbd7                                 XL051k04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NCTCTAGTGAAGAAAGGCTGCCGACGACGGTGAGAATCAGGAAGCAAGCGACGCAGAGGAGAGCATTGATAAAACGGCTGATTCATCCATTTTGGATGATGAAATGGCTCAAGGAGAAGAAGGGGAGTCCCCAGATGGAGAAGATGAATTGGACAATGAAACCGAAAACTaaaaaaaaaa
  5   1   2       bld Ga15                               XL442m11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGAACCGAGCGACGCAGAGGAGAGCATGGATAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGATGAATTGGACAATGAAACCGataaataaaataaaaaaTACAGTTAAAGTGTTCTAAACTTTTTGACAAGTGGTAGTCCTACTGTTTACACTCACAGTAAATGTCCATAGTTTTTATAAGCTGTTCTGTAAAATAGTGTAGCAAGaaaaaaaaaaGTCCATGTCNCNCGGATTTGTCANAAGGTATTTTGGTCATTAAGTATTTTGCAGNGCGTTATTTATTATTCCTAGGAGAAGATGGCATTTCCGAGaaaaaaaaaa
  5   1   2       add Egg1                               PBX0088B10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGGAAAACGGCCGATTCATCTATTTTGGAAGATGAAACGGCACAAGGAGAAGAAGGGGAGTCCCCAGATGGGGAAGATGAATTGGACAATGAAACCGataaataaaataaaaaaataCAGTTAAAGTGTTCTAAACTTTTTGACAAGTGGTAGTCCTACTGTTTACACTCACAGTAAATGTCCATAGTTTTTATAAGCTGTTCTGTAAAATAGTGTAGCAAGaaaaaaaaaaGTCCATGTCACACGGATTTGTCAGAAGGTATTTTGGTCATTAAGTATTTTGCAGTGCGTTATTTATTATTCCTAGGAGAAGATGGCATTTCCGAGaaaaaaaaaaatcttttttttttaaggaaacctacataatgctctgtaggtattttttttctcctttttttACCGTTGGTATTATGAGAGCAGCATTTATTTTAATCATGTTGTGCAAATAGAAGGTGAGGCTGCTTAAGGAAGTATGAAGTTATTTATCAttttttttttCTTTGCTGTGAAGGTCAAGATAAATTTTTACAAGTACATATCATAGC
  5   1   0       add Ga15      out                      XL407o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTATAAGCTGTTCTGTAAAATAGTGTAGCAAGaaaaaaaaaaGTCCATGTCNCACAGATTTGTCAAAAAGGTATTTTGGTCATTAAGTATTTTGCAGNGCGTTATTTATTATTCCTAGGAGAAGATGACATTTTCAAGGaaaaaaaaTCTTTTTTTGTAAGGAAACATACATAANGCNCTGCGGGTAttttttttnccctttttttttttttNCCCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)