Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-XL205o11.5                           11 END     1           6        9                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8738675.5                      96 PI      93          4      875                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012770883 Xl3.1-IMAGE:8738015.5 - 15 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8738015.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGTCATGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCAACTAAGACACATTCCAATATATGAAGTGCAGAAACTTAATGGTGAAATGCAGTCTGTATAAATATGCAGTCCTGTAATAAAATA
                                                  Xl3.1-CHK-1012691574                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCAACTAAGACACATTCCAATATATGAAGTGCAGAAACTTAATGGTGAAATGxAxTxTxxxxAAATATGCAGTCCTGTAATAAAATATGAGTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     4     4     5     8     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    13    13    12    12    13    13    13    13    13    13    12    12    13    13    13    13    13    13    13    13    12    12    13    13    13    13    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13     9    13     9    13     9    13     9    13     9    13     9    13     9    13     6    13     6    13     6    13     6    13     5    13     6    13     5    13     5    12     4    12     3    11     3    11     3    11     3    11     3    10     2    10     2     9     2     8     2     8
                                               BLH ATG       5     116                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR       5     206                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      25       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG       5      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 3e-036     NP_001027685.1 sp1 protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 7e-036     NP_494910.2 ZK546.15 [Caenorhabditis elegans] -------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-039     NP_610437.2 CG34350 CG34350-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ag ---- 1e-040     XP_316711.4 AGAP006674-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 3e-043     XP_781789.2 PREDICTED: similar to LOC561562 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 2e-084     XP_425105.1 PREDICTED: similar to chymotrypsin-like; chymotrypsin-like protease [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 3e-099     NP_001098800.1 chymotrypsinogen B1 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Mm ==== 2e-099     NP_079859.1 RIKEN cDNA 2200008D09 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-100     NP_001897.4 chymotrypsinogen B1 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 1e-100     XP_536781.2 PREDICTED: similar to Chymotrypsinogen B precursor isoform 3 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 5e-101     XP_608091.3 PREDICTED: chymotrypsinogen B1 [Bos taurus] ------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Dr ==== 7e-111     NP_001075159.1 hypothetical protein LOC562139 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 8e-143     AAH64277.1 LOC394984 protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 5e-157     NP_001079917.1 Chymotrypsinogen 2 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8738015.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAA---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAA---------------ATG---------------ATG---------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Panc 5g                         IMAGE:8738989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAAAAATTATCCACGTAAGTCATGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGAAGCAGCATGTGCGCAACAAACAGTCCAGTGTGTACGCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATGTGCTCACTAGACACATTCAATATATTGAAGTGCAGAACCTTATGGGTGAATGTTATTGTTATTGAAAATATGCAAG
  5   1   0       chi Tad1                            IMAGE:6878860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGATCCACGTAAGTCATGGCTTTCCTTTGAGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGTTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTCGTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGATGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAAATTATGTTGGGAGGACCCATCTGTGTTTCCAGTGGATGGGAAAAGACCAGAATTAACGCATTTTCAACTCCCAAACCTACTTCAACAAAACTGCTCTGGCCTCTTGCTGAACAAACGATTCAATGCCAAGAAGCTCCCTGGGGCGAAAATAAAATTCCTTTGGGCTCCAATGAATCCGCCCCCGGGTGGCTGCTTGGGCTccccccccccTGGCATGGGGATGAATTCCGGGTGGGAACCACTTTGTTATGGCCCCAGAACAATAGGCGCCATGGGTCCCCATTGTTTTGCGCATTTGATGCTCCCTGGGGGGAAAAAC
  5   1   2       bld Tad1 5g                         IMAGE:6879524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGATCCACGTAAGTCATGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCTGTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGACATGGTGCATGGTCACTGTTGGCATTGTGTCTGNGGAGCACATGGCGCACAAAGTCCAGTGGTACCCGTGTCCAGTCTCCTC
  5   1   2       bld Panc                            IMAGE:8734471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCAGAATTGCGGTAGCACATCGATAACGATTCGTCCCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTGACGAGATGTTGCTCACTAGACCCATCGATATATGAGTGCAGAAACTTATGGTGAATGTATGTATTGAATATGCAGTTCTGTAATAAAAATTGACTGAAATGTCTGATATTCGGCATGACGTTGCACCTCATGTTTTAGGGATGCCACAAAACACGA
  5   1   2      seed Sp1                    IMAGE:4173750-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAAGTTCTCCGTTCTTGGGTT
  5   1   2       add Panc                            IMAGE:8737312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACACTCCCAAACCTACTTCACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAGAGCTACTGGGAAATAATATCTTGGCTCATGATCTGCGCTGTGCTGCTGCTCTCTCTGCATGGTGATTCTGTGAACCACTTGTATGCAAGACAATGTGCATGTCACTTGTTGCATTGTTCTGGGAAGCGACATGTGGCCCACAAACGTCAGGTGTAACGCATGTCCAGTTTCTGTTCTGGTGACAGATGTGTCTCCACATAGAACTCAATTGAGTGCACCTAAGGAGTAGATGAATGCACCTGGTAAATAGTGA
  5   1   0       chi Panc                            IMAGE:8737679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCCACAGGTGGGATTTCCAACACAATCAACAATGAATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTTCCAGTTTGTCTGGTAATATGGAGAAGAATATGTTGAAGACGCATCTGTGTACCAGTGGATGGGGAAGACAGATACACGCATTTACAACTCAAACTACTTCACAACTGTCTGCTCTGCTGACAAGATAGTGCCAAACTCTGGGAATTATCCTTGCCCAGAATCGCTGGTGCGGCTCCCGCGAGGGATCGGACCTTTGCGGAAAGCGTCCTGGGATGTCCGGAACATGCCCCCACCCCAAGTAAACTGTTCACCTCCGGTCGGCAAGATGTGGCTCAAAAAA
  5   1   2       bld Panc                            IMAGE:8736924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCACAAACAGTCCAGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCACTAGAACACATTCCATATATGAGTGGCAGATCTATGGTGAATTGTATGTATGAGTTGCAGTCCTGTATCACTATGAGTAGAAAAAACACAAAGCAAAATGGGCCGCCGCAGGCCTGATATACTCTCTTGGA
  5   1   2       bld Panc                            IMAGE:8737759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATATATCCTTGGCTCATGATCTGCGCTGTGCTGCTGGCTCCTCCTCCTGCATGGTGATCTGTGACCACTGTATGCCAGACATGGTGCATGTCACCTGTGCATGTGGTCCTGGGGAGCAGCATGTGCCCACAACAGTCAAGTGTGTACGCCGGTCAGTCTCCGGTTCTGGTGAACAGATTGTGGCCTCCACTAGACCTCCATATTGATGCACTACGTACGTATAGTATGATTGCATCTGTAAAAGTGATGGACAACATATAG
  5   1   2       bld Panc                            IMAGE:8738015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCAACTAAGACACATTCCAATATATGAAGTGCAGATCTTAATGGTGAAATGTATGTATGAAATATGCAGTCCTGTATAAAATATGGAGTAGaaaaacaaaaaaaaaaaaaGGGCCGTCTG
  5   1   2       bld Panc      out                   IMAGE:8735574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAGCAGCATGTGCGCAACAAACAGTCCAGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGAATGTGCCTCCACTAGAACATCAATATATGATGCAAAACTATTGGTGGACTGATAATGAAATTGCAGTCTGTATATATTGGATGAAGTCCTGAGATTCAGCATAGCTGCATCATGTTAGATGCCAACGAATCGTTGGAATCATCCGAT
  5   1   2       bld Panc                            IMAGE:8734948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGGTTGACGAGATTGTTGCCTCCAACTAAGACCACATTCCATTTATGAGTGCAGACTATGTGAAATGTATGTATGAATATGCAGTCTGTAATAAATATGGTAGAAAATGTCTGAGTTATTCGCAATGAGTTGCACTCCTGGTTTAGGATGCACAAAACGATTCGATTGGATTCATCAAGATCGCTTCGACGGAATGCGCGATCTTCTTGCCTCACCGTGATCAT
  5   1   2       bld Panc                            IMAGE:8735310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCACAAACAGTCCAGTGTGTACGCCCGTGTTCACCAGTCCTCCGTCTGGGTGACGAGATGTGCCTCCACTAGACCCATCATATATTGAGTGCAGAACCTATGGTGATGTATGTATGGAATATGCAGTCTGTATAAATGGTGCATAAAAATATGGGCAGACGATTTAGATAAAAGCCGCGCAGCCTGATCCTAAGCCGCTGAGCTCGCTATGACCTAGCATTCCCGACGTGATGACTTGGACGCTGTGGCTAC
  5   1   2       bld Panc                            IMAGE:8736065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTTTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCAACTAAGACACATTCCAATATATGAAGTGCAGAAACTTAATGGTGAAATGTAATGTAATGAAATATGCAGTCCTGTAATAAAATATGAGTAGaaaaaaaaaaagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCG
  3   1   2       bld Sp1                             IMAGE:4173750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAGCAGCATGTGCGCAACAAACAGTCCAGGTGTGTACGCCCGTGTCACAGTTCTCCGTTCTTGGGTTGACGAGATTGTTGCCTCCAACTAAGACACATTCCAATATATGAAGTGCAGAAACTTAATGGTGAAATGTAATGTAATGAAATATGCAGTCCTGTAATAAAATATGAGTAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)