Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012771818 Xl3.1-XL187f16.3 - 18 ESTs
                                                                       .-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL187f16.3            CAGGTGTAGGCGCCAGACTCACTCACTGTATATTGGGCAGTTGGGTCTTTAGACTGACACAGAGGGACATTATATAAAACACTTCGGACACACGGGCGAGTCTCCCGGCTGAACAAGGAGGCGGGGCAGAGGCTGTGGCGGGTCACGTGGTGCTAGGACGGGCCGTAGACTCTTTCCGCTGCGCGCTCGTGTGTCGTCATTTCCGGCGCGACTGTTGCTTCTCTGTGGCACTTGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTAAAAAAAAAAA
                                                  Xl3.1-CHK-1012690315                  TAGGCGCCAGACTCACTCACTGTATATTGGGCAGTTGGGTCTTTAGACTGACACAGAGGGACATTATATAAAACACTTCGGACACACGGGCGAGTCTCCCGGCTGAACAAGGAGGCGGGGCAGAGGCTGTGGCGGGTCACGTGGTGCTAGGACGGGCCGTAGACTCTTTCCGCTGCGCGCTCGTGTGTCGTCATTTCCGGCGCGACTGTTGCTTCTCTGTGGCACTTGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTAAAAA
                                                      consensus depths                 2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     6     9     6     9     7     9     7     9     7     9     7     9     7     9     9     9     9     9     8     9     9     9     9     9    10    10    11    11     9    11    11    11    12    12    12    12    12    12    12    12    11    12    12    12    10    11    11    11    11    11    11    11    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    13    13    13    13    13    13    12    12    13    13    13    13    13    13    13    13    15    15    15    15    14    15    14    15    14    15    14    15    14    15    14    15    12    14    12    14    13    14    13    14    11    14    11    14    11    13    10    12    10    12    10    11    10    11    10    11     9    11     9    11     9    11     9    11     9    11     8    10     8    10     8    10     8    10     8    10     5     8     5     5     5     5     4     4     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------C----
                                               BLH ATG     284     649            
                                               BLH MIN     284     154            
                                               BLH MPR     284     154            
                                               BLH OVR     284     596            
                                               CDS MIN     284     154            
                                               ORF LNG     284      36            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ==== 4e-030     XP_001188040.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Ce ==== 4e-062     NP_505803.1 putative protein, with 2 coiled coil domains, of eukaryotic origin (31.3 kD)(5L480) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === At ==== 1e-071     NP_188509.1 expressed protein [Arabidopsis thaliana] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ag ==== 1e-081     XP_313133.3 AGAP004225-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 1e-092     NP_649768.2 CG9667-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 3e-131     NP_001077032.1 RAB43, member RAS oncogene family [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Bt ==== 8e-136     XP_001251393.1 PREDICTED: hypothetical protein [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 7e-136     NP_065752.1 KIAA1160 protein [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 3e-136     XP_849089.1 PREDICTED: similar to CG9667-PA isoform 6 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Mm ==== 9e-137     NP_598695.1 RIKEN cDNA 5830446M03 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 1e-138     XP_414311.1 PREDICTED: similar to Hypothetical protein MGC76019 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 4e-152     NP_989022.1 hypothetical protein MGC76019 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 1e-161     NP_001085511.1 MGC80278 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL187f16.3                                                                                      TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------TAAATG------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073408.5p CCACGCGTCCGCAGGTGTAGGCGCCAGACTCACTCACTGTATATTGGGCAGTTGGGTCTTTAGACTGACACAGAGGGACATTATATAAAACACTTCGGACACACGGGCGAGTCTCCCGGCTGAACAAGGAGGCGGGGCAGAGGCTGTGGCGGGTCACGTGGTGCTAGGACGGGCCGTAGACTCTTTCCGCTGCGCGCTCGTGTGTCGTCATTTCCGGCGCGACTGTTGCTTCTCTGTGGCACTTGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACA
  5   1   2       bld Ov1  5g                IMAGE:5073408-IMAGp.IMAGp            CAGGTGTAGGCGCCAGACTCACTCACTGTATATTGGGCAGTTGGGTCTTTAGACTGACACAGAGGGACATTATATAAAACACTTCGGACACACGGGCGAGTCTCCCGGCTGAACAAGGAGGCGGGGCAGAGGCTGTGGCGGGTCACGTGGTGCTAGGACGGGCCGTAGACTCTTTCCGCTGCGCGCTCGTGTGTCGTCATTTCCGGCGCGACTGTTGCTTCTCTGTGGCACTTGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAG
  5   1   2       bld Ga12 5g3  in                         XL187f16.5p                                                                                                             GAGTCTCCCGGCTGAACAAGGAGGCGGGGCAGAGGCTGTGGCGGGTCACGTGGTGCTAGGACGGGCCGTAGACTCTTTCCGCTGCGCGCTCGTGTGTCGTCAATTCCGGCGCGACTGTTGCTTCTCTGTGGCACTTGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGCGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGTGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAANACCCGCACTGAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764365.5p                                                                                                                                                                                                                                                    TGCGTCTCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGG
  5   1   2       bld Ga18 5g3  in                       xlk68g06ex.5p                                                                                                                                                                                                                                                            TCACTGTGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGNTCGGAATGCAGAGAAAGCCATGACGGCATTGGNACGGTTCCGCCNNCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGNCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGNNNNNTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCNATGGGGANAAGAATGAGGAGGAAGAGGNAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTNATGATGATGAAGGCNCAGAGGGGGAGGNGGNNNNCAGAAANTT
  3   1   2       bld Ga18 5g3  in                       xlk68g06ex.3p                                                                                                                                                                                                                                                              TCNCTGTGNNNCTGACNCGCNTGTAACTNCNNGGTNNNGTCGCATGGCTNGGANTGCAGAGAAAGCCATGACGGCATTGGCACGNTNCNCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGNAGNCCNTTCCTGGCCTCGGAGTGTTCTGANCTGCCCAAAGCCGAGAAGTGGAGNCGANAGATAATCGGAGAAATATCAAAGAAANTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTNCAAGATNCGAGACGTGAATGATGAAATTANCAANCTCATNAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGNTCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTNCCGGTGCCGTCACAGAAGGAGATGGAGGAGCGCTGGTGCGCAGGAAGAAGATGGANCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATNTCTCNTCTGTNCCTGGGTGTATATTTGTACA
  5   1   2       bld Brn1 5g                         IMAGE:6955386.5p                                                                                                                                                                                                                                                               CGGCTGGTCCGGTCCGGATTCTCGGGATCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCGAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCCGAAACCGTGGGTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGTGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGACGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGGAGAAGACAGTGATGATGATGAAAGCGCAAAGGGGGGAGAGGGACAACGGAAATTTATCGCTCACGTGCCGGGTGCCGTCACAGAAAGGAAATGGGAAGAAGCCGCTGGGTGCCCCAGGAAAGAGAATGGAGCTGCTGCCGAAAATCCGCGAG
  5   1   2       bld Ga15 5g3  in                       XL466f05ex.5p                                                                                                                                                                                                                                                                TGTTTCCTGACGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGANAANAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAANAATGANGAGGAANANGAANTGAATATTTATGCTGTGGCTGCGGATGANTCCNGGANAANACANTGATGATGATGAA
  5   1   2       bld Ga12 5g                              XL200d24.5p                                                                                                                                                                                                                                                                       CGAGGCCGCTTTGTAACTCCCGGTGCTGTCGCCATGGCTCGGAATGCAGAGAAAGCCATGACGGCATTGGCACGGTTCCGCCAGGCCCAACTGGAGGATGGGAAAGTAAAGGAGAGAAGACCATTCCTGGCCTCGGAGTGTTCTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGTGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGACGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAG
  3   1   2      seed Ga12 5g3  in                         XL187f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                    TNTGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGCGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGTGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGACGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACA
  3   1   2       bld Ga15 5g3  in                       XL466f05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCAAAGCCGAGAAGTGGAGNCGACANATANTCGGAGAAATATCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACAAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGAGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCCCTGGGTGTATATT
  3   1   2       bld DMZ                                 rxl237d10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATNTCAAAGAAAGTGGCCCAGATTCAGAATGCCGGACTCGGGGAGTTCAAGATACGAGACGTGAATGATGAAATTAACNAACTCATCAGAGAGAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGAGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAGCTGGGTGGTCCAGACTATGGGCGCATTGGGCCCAAGATGCTGGATCATGAAGGGAAGGAAGTGCCCGGAAACCGTGGTTACAAATACTTTGGTGCCGCTAAAGATTTGCCGGGCGTCCGGGAGCTGTTTGAGAAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL480i23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGACGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL480i23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAGCCCCTTCCGCCCCCCAGGAAGACCCGCACTGAGCTGATGAAGAGCATCGACGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTATCTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGAGCATCGATGCTGAATATTATGGCTACCGAGATGAGGATGACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGGGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Ga15      in                       XL476n18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACCTGGGTGTATATTTGTACAGAGCTGAGCAATAAACATGGACTTTTCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL476n18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGGGGTGCTGGTGCCTCTGGAGCAAGAGCAGGAGAAGAAAGCAATCGCGGAGGCGCTGGAGAAATGGCGGCTGGAGAAGGAGGAGCGTCTGGCCAATGGGGACAAGAATGAGGAGGAAGAGGAAGTGAATATTTATGCTGTGGCTGCGGATGAGTCGGGAGAAGACAGTGATGATGATGAAGGCGCAGAGGGGGAGGAGGGACAACAGAAATTTATCGCTCACGTGCCGGTGCCGTCACAGAAGGAGATGGAGGAGGCGCTGGTGCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCGAGTGAGACGTTACTGGCGCAGAGTGAAGATGCAAAACGACTGTTAGGCGTATAAATGACTCGTCTGTACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)