Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6880961.3                       5 END     2          12       40                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6879744.5                       6 PI      95        860     1104                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012771964 Xl3.1-IMAGE:4173753-IMAGp.5 - 16 ESTs
                                                                       .-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4173753-IMAGp.5                                CGGACGCGTGGGCTTGTCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAAGGATTTTGGAGGAAACCCACAGTCAGTTACAATATTTGGAGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTCTAAGGGATTGTTCCAAAGAGCCATATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTGATGGCCAGTAAAACTGAAGAGATTCTACCTATTCTCCATGTGGTCGCTAACATATCCTCCTGCAGTGTATCGAGCCTGGCAGACTGTTTAAAAAAGAAAACAGAAGATGAGATTGTTGAGATTTCTGCAGCGATGAAATTTGTAGCCTTTCCTGCTGTTGTCGATGGGGTGTTCCTTCCCAAACCTGCTGAAGAGATCTTAGCTAGCAAGGAGAGCAATCCAGTTCCTTTTTTGAT
                                                  Xl3.1-CHK-1012691260                                      CGTGGGCTTGTCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTCCGTGATAATATTAAGGATTTTGGAGGAGACCCACAGTCAGTTACAATATTTGGAGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTCTAAGGGATTGTTCCAAAGAGCCATATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTGATGGCCAGTAAAACTGAAGAGATTCTACCTATTCTCCATGTGGTCGCTAACATATCCTCCTGCAGTGTATCGAGCCTGGCAGACTGTTTAAAAAAGAAAACAGAAGATGAGATTGTTGAGATTTCTGCAGCGATGAAATTTGTAGCCTTTCCTGCTGTTGTCGATGGGGTGTTCCTTCCCAAACCTGCTGAAGAGATCTTAGCTAGCAAGGAGAGCAATCCAGTTCCTTTTTTGATTGGTGT
                                                      consensus depths                                     2     3     3     5     5     7     9     9    10    10    10    10    10    10    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    15    15    15    15    15    15    13    15     9    14     9    13     8    13     7    12     6    11     4    10     4    10     4    10     4    10     3    10     3    10     3     7     3     6     3     6     3     6     3     5     3     5     3     5     2     5     2     5     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                        G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -G----------
                                               EST CLI     -40       2                                
  5   1   2       bld Int2                            IMAGE:8530157.5p AAAATTTACCTGTTGNNNGAGATCATCNATTAAATTCGTCCCCTCTTGTCGGGCTGCTACCCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAGATGGGTTCGTGAATATATAAGGATTTTGGGAGAACCCCAGTCAGTTACATATTTGGGAATCTGCAGGCGGAGGAGTGTTCTGCCCAGTATGTCCCACTTCTNAGGATGTTCCAAGACCAATCTGAATGAG
  5   1   2       bld Kid                             IMAGE:7008118.5p                    CCCACGCGTCCGCGGACGCGTGGGCTTGTCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTTAAAATGGTTCGTGATAAT
  5   1   2       bld Kid                             IMAGE:7009710.5p                    CGGACGCGTGGGCGGACGCGTGGGCTTGTCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCATGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCANGTTGCAGCTTTTAGATGGGTCCGTGATAATATAANGGGATTTGGANGAA
  5   1   2       bld Int2                            IMAGE:8824373.5p                                         GCTCTTGTCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCACGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAATGATTTTGGAGGAAACCCACAGTCAGTTACATATTTGGGGAATCTGCAGCGGATGATGTTTCTGCACAGTATGTCCCACTTCTACGGATGTCTAGAGCCATATCTGAAATGGAGTGCAATACTCCTATT
  5   1   2       bld Int2                            IMAGE:8531056.5p                                           CTCTTGTCGGGCTGCTACCCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCATGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAGATGGGTCCGTGATATATTAGGATTTTGGAGAGACCACAGTCAGTACATATTTGGAGATCTGCAGGCGATGAGTGTTCTGCCAGTATGTCCCACTTCTANGGGATGTCAAGATCTATCTGAATGAGTGCAT
  5   1   2      seed Kid                             IMAGE:7008486.5p                                                TCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCATGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTCCGTGATAATATTAAGGATTTTGGAGGAGACCACAGTCN
  5   1   2       bld Int2                            IMAGE:8820974.5p                                                TCGGGCTGCTACACCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAAGATTTTGGAGGAAACCCACAGTCAGTTACAATATTTGGGGAATCTGCAGCCGATTGAGTGTTTCTGCACAGTATTGTCCCCCCCTTTCTAGGATGTCCAAGAGCCATATCTGAGAGTGAGTTGCATACTTCCTAGTTTGATGGCCCAGTTAAAACTGTGA
  5   1   2       bld Sp1                    IMAGE:4173753-IMAGp.IMAGp                                                             CCAGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAAGGATTTTGGAGGAAACCCACAGTCAGTTACAATATTTGGGGGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCCACTTTCTAAGGGATTGTCCCAAAGAGCCATATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTTGATGGGCCAGTAAAACTGAAGAGATTCTACCTATTCTCCATGTGGTCGCTAACATATCCTCCTGCAG
  5   1   2       bld Sp1       out                   IMAGE:4173753.5p                                                               AGCATTACAAGTTTCTTTCTTCAGTGTGTTTGGCCATTCAGCAAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTNTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTNTGAAGGCTCTGCTNTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGG
  5   1   2       bld Int2                            IMAGE:8529762.5p                                                                       CAGTTTCTTTCTTCATTGCATTTGGCCATTCAGCAAAGCGTTTCCTATTCATGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTCCGTGATAATATTAAGGATTTTGGAGGAGCCCACAGTCAGTTACATATTTGGAGATCTGCAGCGGATGAGTGTTCTGCACAGTATGTCCCACTTCTANGGGATGTCNAGAGCATACTGAAATGAGTT
  5   1   2       bld Kid                             IMAGE:7009057.5p                                                                                                         AAAGCGTTTCCTATTCGTGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCACAGCCACCAGAGCCATGGAGTTCTATCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTTCGTGANTATATTAAGGATTTTGGANGAAACCCACAGTCAGTTACAATATTTGGGGAATC
  5   1   2       bld Tbd7      out                        XL072a12.5p                                                                                                             CGTTTCCTATTCATGCTGATTTTCTACAAATGGAATCCCTGATTAAAGTTCTTCTCTTGTGCTGTGCGACCCTGGGAATCTATGGAACGGAGGATGCAAGGCCACTATTGACAACAAACTATGGGCAGCTTCTTGGAAAAACAGTGGGTGCAAAGGAAACCGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAAGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATA
  5   1   2       bld Tad1                            IMAGE:6939063.5p                                                                                                                                                                                                                                    GGGGGCAGCTTCTTAGGAAAAACAGTGGGTGCAAAGGAAACTGACAGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCTAAGCCTCCTATAGGACCATTAAGATTTCAGCATCCACAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATATAAAAGGAATGGAGCTACTTGCTGATTTTTTCAAGGCAAAATTAGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACGCCGGCAGACAGAGGAGAGAACCCAGAGCTCCCCGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTAGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAAGGATTTTGGAGGAGACCCACAGTCAGTTACAATTTTTGGGGAATCTGCAGGTGCATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTTCTAAGGGATTGTTCCCACAGAACCATATCTGAAAGTGGAATTTGCAATACTTCCCTGGTTTTGATGGGCCAATAAAACTGAAAAAGATTCTAACCTATTCTTCCCTCTGGGTCGCCTAACATATTCCTCCTTGCAAGGTAATCCAGCCATTGGC
  5   1   2       bld Kid                             IMAGE:4031099.5p                                                                                                                                                                                                                                                       CCCTGCATATCGTCGACCACGCGTCCGGATTAATTCATGTTTTTATGGGCGTTCCTTTTGCAAAGCCTCCTATAGGACCATTAAGATTTGAGGATCCGCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTCCGTGATAATATTAAGGATTTTGGAGGAGACCCACAGTCAGTTACAATATTTGGAGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTCTAAGGGATTGTTCCAAAGAGCCCTATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTGATGGCCAGTAAAACTGGAGAGATTCTACCTATTCTCCCTGGGGGTCGCTAACATAATCCTCCCTGCAGGGGTATCAAAACCCTGGGCAAAACTGGTCTCACAAAACGAAACACCGAAAGATGGAGAATTGGTTTGCCAATTTTCCTCGCCACCCAGATTAAAAATTTCTGTAAGACCCCTTTTCCCTGCCCGTGGTTGGGCCCGAATggggggggggtttcccccttcccccccAAAAACCCTGGCGCTGAAAAAAAGAAGAACTCTCT
  5   1   2       bld Kid                    IMAGE:4031099-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                        GCAGCCACCAGAGCCATGGAGTTCTGTCAGGGAAGCTACAGAAAATCCGCCCATGTGTTTACAAGATAAGAAAGGAATGGAGCAACTTGCTGATTTTTTCAAGGCAAAATTTGATTTTCCTCCGGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCGGCAGACAGAGGAGAGAACCCAGAGCTACCTGTCATGGTGTTCATACATGGAGGAGGACTTACCATGGGAGGAGCAGGCATGTTTGAAGGCTCTGCTTTAAGTGCCTATGAAAATGTTGTGGTGGTGTCAATACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGTGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTCCGTGATAATATTAAGGATTTTGGAGGAGACCCACAGTCAGTTACAATATTTGGAGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTCTAAGGGATTGTTCCAAAGAGCCATATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTGATGGCCAGTAAAACTGAAGAGATTCTACCTATTCTCCATGTGGTCGCTAACATATCCTCCTGCAGTGTATCAAACCTGGCAGACTGTCTAAAAAAGAAAACAGAAGATGAGATTGTTGCGATTTCTGCAGCGATGAAATTTGTAGCCTTTCCTGCTGTTGTCGATGGGGTGTTCCTTCCCAAACCTGCTGAAGAGATCTTAGCTAGCAAGGAGAGCAATCCAGTTCCTTTTTTGATTGGTGTTAATAATCATGAATTTGGCTGGATACTGCCCTTGGCACTTAATATCAGTGGATATAGGG
  5   1   2       bld Kid                             IMAGE:4031919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGACAGTACAGACTTGGCATTATGGGATTCTTTAGTACTGGTGATAAAGAAGCACGCGGGAACTATGGCTTTCTGGATCAGGTTGCAGCTTTAAGATGGGTTCGTGATAATATTAAGGATTTTGGAGGAAACCCACAGTCAGTTACAATATTTGGGGAATCTGCAGGCGGATTGAGTGTTTCTGCACAGGTATTGTCCCCACTTTCTAAGGGATTGTTCCAAAGAGCCATATCTGAGAGTGGAGTTGCAATACTTCCTAGTTTGATGGCCAGTAAAACTGAAGAGATTCTACCTATTCTCCATGTGGTCGCTAACATATCCTCCTGCAGTGTATCGAGCCTGGCAGACTGTTTAAAAAAGAAAACAGAAGATGAGATTGTTGAGATTTCTGCAGCGATGAAATTTGTAGCCTTTCCTGCTGTTGTCGATGGGGTGTTCCTTCCCAAACCTGCTGAAGAGATCTTAGCTAGCAAGGAGAGCAATCCAGTTCCTTTTTTGATTGGTGTTAATATCATGAATTTGGCTGGATACTGCCCTTTGGCACTTAATATCAGTGGGATATAGGGGAAGGAATTGGAGAAGAAAAGACTTTTCAGTCAATAACTCGTTGGCTCCTTCCTTTTTGGGGCATTCCTTTTACCAATTGGTGTTCCCTTTTCATCCCGGGGAGGGAGTACTTTTGGGCGACCCCAAATGGATCCAAAAGGAACCTTAGAAAACCATTTTTccttaaaaccctagtttggggggaaaaattaaaattttggtccaaaaccgggccccttaaaaaaACAGCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)