Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7207716.5                       7 PI      90          5      759                hypothetical protein LOC735008 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012771979 Xl3.1-IMAGE:7206328.5 - 18 ESTs
                                                                       ..-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7206328.5                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTT
                                                  Xl3.1-CHK-1012690438                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTACAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     4     5     5     6     7     7     7     7     7     8     7     8     8     9     8     9     8     9     8    10     9    10    11    12    12    13    12    13    12    13    12    13    12    13    13    14    13    15    13    15    13    15    14    16    14    16    12    16    14    17    15    17    16    17    16    17    16    17    15    17    16    17    16    17    16    17    16    17    15    17    15    17    14    16    15    17    14    16    15    16    14    15    14    15    14    15    14    15    13    15    12    15    12    14    11    14    11    14    11    14    11    14    11    14    10    13    10    13    10    13    10    13     8    12     8    12     7    11     6    10     6     9     5     8     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           A-----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN -== Ce ==== 5e-058     NP_498121.1 yeast HydroxylAminoPurine sensitivity related (20.5 kD) (hap-1) [Caenorhabditiselegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Os ---- 7e-061     NP_001064763.1 Os10g0457500 [Oryza sativa (japonica cultivar-group)] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 8e-064     XP_001184472.1 PREDICTED: similar to putative oncogene protein hlc14-06-p, partial [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- ?? ==== 2e-067     XP_637700.1 inosine triphosphate pyrophosphatase [Dictyostelium discoideum AX4] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 1e-070     NP_608890.1 CG8891-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ag ==== 4e-071     XP_317079.2 ENSANGP00000019707 [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-084     NP_001093456.1 hypothetical protein LOC557834 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 2e-086     NP_258412.1 inosine triphosphatase; Inosine triphosphatase-A [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 7e-088     XP_422234.1 PREDICTED: similar to Inosine triphosphate pyrophosphatase (ITPase) (Inosine triphosphatase) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 5e-088     XP_851574.1 PREDICTED: similar to inosine triphosphatase isoform a [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-088     NP_080198.2 inosine triphosphatase; nucleoside triphosphate pyrophosphatase [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bt ==== 3e-089     NP_001069750.1 inosine triphosphatase [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 4e-113     NP_001089939.1 hypothetical protein LOC735008 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7206328.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA------------TAA------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2      seed Te2N                            IMAGE:7206328.5p                                                                                                                                                                                                                                                                                                                                                                                                              CTTCATTCTACATAACGCTGACCATGGCAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTGCATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTACATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGGCGCCGCTTAATTTACCCTCCAGGAGGGGTCCCCATATAGTGAGTCCTTATTAAA
  5   1   2       bld DMZ       in                         xl245c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACNAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAANGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTANAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTAC
  5   1   2       bld He1       in                    IMAGE:4408564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCAAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGT
  3   1   2       bld Ga15                               XL498k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCCGGCAGGGAGTATTAGTCTTTGTAANCNGGGAACGCGAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAATTTTCCATGCAAATTAGTAGCCAAGAAAATTGACTTGCCGGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATNGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCTGACTACTTCATCCAGAATGGCACGAAGGTTNGATGTTTCAATATCTAAAGGTTTTCTGTGAAGCATCCTCTGTGTTTCTAAAAATGTTACNCAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAACAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTATCCTGTAAATGATA
  5   1   2       bld Emb1                            IMAGE:6633328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAGAAGANATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTANAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATNTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGGTATGATGCTTATGTATAACTTAATAAATTTTTAATACCTTTTaaaaaaaaaaaaaaaaaaGGCCGGCCCGCCTCCTAAAGTATCCCCTCGAAGGGGGGCCCCAAGGCTTTACCGCGGTACCCCCAGCTTTTTCTTTGGTACCAAAGGTGGGGTCCCCCTTAATA
  5   1   2       bld Egg1                               PBX0095B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGTATAGTTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCATATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTNAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAG
  3   1   2       bld DMZ       in                         xl245c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTNGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATG
  5   1   2       bld Ov1                             IMAGE:6318421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGAGGTTGTTCAGATTCTCTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAAGAAATGTCGGACTACTTCATCCAAAATGGCACGAAGGTTTGATGTTTCCACCATCTAAAGGTTTTCTTGTGAAACATCCCTGTGGTTCTAAAAATGGTACACCAAAACTTTGGAACGTCGGGGGTACTCCCTTTCCCCCAAGAAAAGGGGTAACCTTTTGAAAAGTTTTCCATGAAGGTGCATCCCCTTCCCTGGTAAATGGTAATGAAGCTTTATGCATAAACCTTTAAAAAATTTTTAATAACTTTTACCCTTAACGACATCCAATACGGGGCGGGCCCCCTCTAAAAATAATccccccccAAGGGGCCCCAAAGCCTTTACGCGGTTCCCCCGTTTTTTCCTTGGCACAAATAAGGGGCCCCTTATAAATTAGAAATCCCCTCTATAAAGCCCGTAAGGCCCCTTGGGGCTGGACTCttttttttAAAACACCCCCGCGATAAN
  5   1   2       bld Egg1      in                    IMAGE:4783430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGACAAATTTCCATGCAAATTAGTTGTCACCAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTATATTTTTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAA
  5   1   2       bld Ga12      in                         XL142c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAATTGACCTGCCANAGTATCAAGGAGAACCANATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCT
  3   1   2       bld Ga18      in                       xlk64f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGANNNNNAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGNTTATGTATAA
  5   1   2       bld Ga18      in                       xlk64f16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGANCCAGATGAGATTTCCATTCAGAAATGTAGAGAGGNAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGNTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTNAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAAACTTAATAAATTTTAATACTTTTACNT
  5   1   2       bld Egg1                               PBX0135F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAAGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACAT
  3   1   2       bld Egg1      in                    IMAGE:4783430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTCCATAAAAAAAAAAAAAAA
  3   1   2       chi Neu7                                 XL033k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGCTGCCCGTCTGTATCTGGCATATGCAAAGATGATTAATATCTTGTCGCCTAATTATTTTATTCTTTAGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACGTAAGCATTTATATGCAGGTTATTATGACGTATCAGATCCTCATAGCCGCAATTGGAACTGTTTACTGAAATCAGAAGGCAGATTATTTGATGTGACTCTCATTACAGTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCTGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAA
  3   1   2       bld Ga12      in                         XL142c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGNCTGCACCGAATGTTAGAAGGATTTGAGNACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCNTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCTGACTACTTCNTCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTNAAGCATCCCTGTGTTTCTAAAAATGTTAC
  3   1   2       bld He1       in                    IMAGE:4408564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCTGCACCAAATGTTAGAAGTATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGAAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTACATA
  5   1   2       bld Ov1                    IMAGE:6318421-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTATAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCCCAGAAAGGCTACATTTGAGAGTTTTCATGAAGTGCATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)