Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL196l15.3                           18 END     12         70       66                hypothetical protein LOC100101302 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl247a14.3.5                         26 PI      88         29      778                CDC-like kinase 3 [Mus musculus]

 This cluster: approximate FL confidence score = 73%

 1012772025 Xl3.1-IMAGE:5083955.5 - 17 ESTs
                                                                       .......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5083955.5                  GACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGGCTGCTGGGGAAAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGCACATGGCCTTCCAGTTGTGCCACG
                                                  Xl3.1-CHK-1012690929                        TATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGxxxxxxGGGGAAAxxxAxATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGCACATGGCCTTCCAGTTGTGCCACGCCATTA
                                                      consensus depths                       6     6     9     9    10    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    15    14    15    14    15    14    15    14    15    14    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    17    10    17    10    17     9    17     9    16     9    16     8    14     8    14     8    14     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    12     7    12     6    12     5    10     3    10     3     9     3     8     3     8     2     7     2     7     2     6     2     6     2     6     2     6     2     5     2     5     2     5     2     5     2     4     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCACTTTTGA
                                                                   SNP                                                                                                                                                      ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                              ---------T--
                                               BLH ATG      26     169                  
                                               BLH MIN      14      96                  
                                               EST CLI      -3       9                  
  5   1   2       bld Emb9 5g3  out                   IMAGE:7973898.5p GTGCGGATTCCCGGGATGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTCCATGGACTGTTCTGCTTGCCTTGAGCTGCTGGGAAAAGCACTTTGAGTTTAGAAAGAAATAATTCTTACCTATCTCTGACCATATCGGCACATGCCTTCATTGTGCACCATTAAGTTTTCTGAAATCGTGACACATGACTAACTGAAACTTTCTTTGATCAAATTATCTGTCATAATAAAATTGAAAACTTAAATCTCTCTTATACTGGGGTCTTAAGAATCCTATACACCTCCA
  5   1   2       bld Tbd7 5g3  out                        XL080e06.5p      GCTTTTCCTGCGGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCGGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGACGCAGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGCAGCTACTCTTCCTCGATGAGATTGTTGGAGATTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTCAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACT
  5   1   2       bld Emb9      out                   IMAGE:7976703.5p      GCTTTTCATGCGGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAATTAATGTCTTGGAGAAAATCTAAGAGCAAGATCAGGACCAACAAAATATGTGTGTCTTGATGAGGGACTGTGTTGATTCCATGGACATG
  5   1   2       bld Spl  5g3  out                   IMAGE:8464332.5p      GNTTTTCCTGCGGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGCACATGGCCTTCCAGTTGTGCCACGCATTAAAGTTTTGCATGAAAATAGCTGAACC
  5   1   2       bld Oo1  5g                         IMAGE:5083955.5p            CATGCGGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGCACATGGCCTTCCAGTTGTGCCACGCCATTAAAGTTTGTTGCATGAAGAATCCAGCTGGACACACAACTGGACNTCCAA
  5   1   2       bld Em10 5g3  out                   IMAGE:7981771.5p              TGCGGACGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGGAATTAATGTCTTGGAGAAAAATCAAGAGCAAGATCAGGGACACAAAAATATGTGTGTCTTGA
  5   1   2       bld Tbd3 5g                         IMAGE:3548185.5p                    CGTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATTCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGATGGAGTGTCTGGATCTTACCAGAGGCAGG
  5   1   2       bld Em10 5g                         IMAGE:7979159.5p                     GTCTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGATAATTTCTTACCGTATCCTCTGACCATATCCGGCACATGGCTTNNCAGTGTGCACGCATTAAGTTTTGCATGAGATCAGCTGACCAACTGACTCAAACTGAGACATCTCTTGTGATTCAAATATGACTCGCTCATGAGATA
  5   1   2      seed Ga12 5g3  out                        XL196l15.5p                       CTATCTTATGTGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGA
  5   1   2       bld Oo1  5g                         IMAGE:6639302.5p                                 TGATGCACAGAAGAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAGAGCAAGATCAGGANCACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTNTGAGCTGCTGGGGGAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGGACATGGGCCTTCCCGTTGTGCCCACGCATTAAAGGTTTTTGCATTGAGATTCAAGCTGGACACACACCTGGACCCTCAAAACCTGAAAAAACATTCCTCCTTTTGTGAATTTCCAGAAAATATGGAACGGTTCTGTCTTC
  5   1   2       bld Gas5      out                   IMAGE:3749788.5p                                      GGAATTCCAAGGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTANGAATAGGGACTTTATGCAAAGTGGTGGAGTGTCTGGATCTTGGCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGGAAATAATGTCTTGGAGAGAATCAAGAGCAAG
  5   1   2       bld Egg1                               PBX0077D11.5p                                                GGAATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGACGACTACGTACACACAGAATCTCCCCACATGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTGTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTACAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGG
  5   1   2       bld Gas5      out                   IMAGE:3749787.5p                                                  AATTGGTCAGCTAAAGAAGAGGATATAGTCCAAACATGGAAGAGGAGGAGGAGATCCCCAAGCAGAGACCGCGAGGGCCGCCGACTACGTACACACAGAATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGGCAGACGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAAG
  5   1   2       chi Ga15      out                      XL504o14ex.5p                                                                                                                                                     ATCTCCCCACGTGCACACAGAATCTCCCCATATAGGTCTCGCTCAAGAAGCTGGAAAAGGGACACATTTCTTGGGCGCCGAAGGAGGACACGCTGTAGTGAGGTTCGATTTTCTCAAGGGCACAGTTCTTCATCCCACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGTGCTTCACATCTGAAACCTGTAAATANGTAAAGAAGAAAGGCAAATAATTGAAAGTGATGGCCAACAGCTTCTGTGTACTAGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGATGCTTANGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTG
  5   1   2       chi Tbd7      out                        XL066d16.5p                                                                                                                                                                                                                       CGCTTTNGTCTGCCCTTTATGCTGAGCTGTCTCTAACCTGCACATATCCCTTTGCAATATTCCCTATCGTTCTATGTTTTTACTCACCCGCACACCTCTCAATCACCATCGTCTTGGACCTGTGCCGTGTTAATATCCCTGACTCCCTGATTTGAACCACCTTTGGAAACCACACGTTGTGTCTGTTGTGGGCGGTTGGGTGAGCAGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACTTAGGAATAGGGACTTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAATTCCCGAGTAGCTCTTAAGATCATCCGCAATGTGACTAAATACCGGGAGGCAGCACAGCTGGAAATTAATGTCTTGGAGAAAATCAAAGAGCAAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGCTGCTGGGGAAAAGCACTTTTGAGTTTCAGAAAGAGAATAATTTCTTACCGTATCCTCTGACCCATATCCGGCACATGGCCTTCCAGTTGTGCCACGCATTAAAGTTTTTGCATGAGAATCAGCTGACACACACTGACCTCAAA
  5   1   2       bld Tbd7      out                        XL061i14.5p                                                                                                                                                                                                                                                                                            CACAGCCAGAGCTATTCATACTCCACCCGGTCTCCAGCTTGTCCACACTCAAGAGAACGCACAAAGGCAAAAGCAGAGAAACCTCTGCACAAGAGCTCTCACAAACATCGGACTCGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGA
  5   1   2       bld Ga12      out                        XL194d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCNNAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCAGGACGGGAGAACGCATCCGGGAGAGATATGAGATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)