Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl315l15.5                           20 END     8          36       40                homeobox Iro protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012772031 Xl3.1-xl315l15.3 - 22 ESTs
                                                                       ....-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl315l15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAA
                                                  Xl3.1-CHK-1012689380                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     5     6     6     6     5     6     6     7     5     8     5     8     6     8     6     8     6     9     6    11     6    12     7    13     7    13     7    13     9    14     9    14    10    15     9    15     9    15    12    15    12    15    13    16    13    16    13    16    13    16    13    16    12    16    13    16    12    16    11    17    14    17    14    18    15    18    15    18    14    18    15    18    14    18    14    18    15    18    16    17    16    17    16    17    16    16    16    16    16    16    16    16    16    16    16    16    14    16     9    16     9    16     9    16     9    16    11    16    11    16    11    16    11    16     9    16    10    16    10    16    10    16    10    15     8    14     8    14     8    14     8    13     8    13     3     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTAAGTTACAATTTAGCTGCAGATTTGCCAGTAGTCCTGATACAGGCAAGCTAGCACTGACTGTGATTGAGATAAGGTCAAGAGAGAAATAAATATCAGCTGGCCACCAAGCACTTGCTGCCGAGTGTTTCTGTTATTTCAACTGATGTCTTGTTTTCTTCACAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGTAAGTATTCATCGGAAACAAAGAAAAAAATGCAAAGATGAACCATGTTATTAATTTTTAAATCTCTAATTGTTATCTCTTTCTTCCTTCCAGCACCCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T--A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------GA-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G---T-
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 5e-017     NP_001071747.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-016     NP_729818.1 mirror CG10601-PB, isoform B [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-017     NP_492533.2 IRoquois subclass of homeoboX family member (irx-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Ag ---- 8e-018     XP_315118.4 AGAP005011-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sp ---- 4e-018     NP_001123285.1 iroquois homeobox A [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Cf ---- 1e-023     XP_544403.2 PREDICTED: similar to Iroquois related homeobox 3 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Bt ---- 4e-080     XP_001251877.1 PREDICTED: similar to homeodomain protein IRXA1 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 9e-092     NP_034703.2 Iroquois related homeobox 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 1e-093     NP_077313.3 iroquois homeobox protein 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dr ---- 7e-094     NP_997067.1 iroquois homeobox protein 1, a isoform 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 1e-126     NP_001025509.1 iroquois homeobox protein 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 5e-171     AAT72003.1 iro1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 2e-176     NP_001081649.1 homeobox Iro protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl315l15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------ATG------------------------------------------------TGA---------------------TAA---------------------------------------TAG---------------------------------------------TAA------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Tad1                            IMAGE:6938879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACCCAGGGCGACCCAAGAATGCCACCAGGGAGAGCACCGGCACTCTAAAGGCTTGGCTCAACGAGCACAGGAAGAACCCATATCCAACCAAGGGGGAGAAGATCATGCTGGCCATAATCACCAAGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCGACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAAGCAAATCACACATCCTCCCCCCAATCCAGCCACCCAGNCCTTTTCCTACCCCAGCCATGGGAACTATTAACACGTTGGCCAAAATTTGGGCAAAATTTTCCACCAAACC
  5   1   2       bld DMZ       in                         xl287l18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGNTTCNNATTCNGCACGAGGCANGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTT
  5   1   2       bld DMZ       in                         xl286l18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCANCAAGCTCCATT
  5   1   2       bld DMZ       in                         xl313p01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAATGCCAGAAGGAGGCTTAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGAAGTAAGGAAGATGACAACATCTTTGGCAGTGATAATGAAGGAGACCATGAAAAAAATGAAGATGATGAGGAAATTGACTTGGAGAGCATAGACATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAACGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCAGACGGCCTTAAACCAAAAGACTCAATGTCGCTGGGTAAGGAAAGTTCTGATACTAGCAATACCAGAATCGTAAGTCCTGGTGGACAGGGCAACATACAAGTGCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGG
  5   1   2       bld Ga18                               xlk76i20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATGACAACATCTTTGGTAGTGATAATGAAGGAGANCATGAAAAAAATGAAGATGACGAGGAAATAGACTTGGAGAGCATAGATATTGATAAGATTGATGACAACGACGGTGAACAAAGCAACGAGGAAGAGGATGAGAAACTGGACCACTTTAGACATGGCGAGAAAGTAAGTTTGAAAAAGGAGAGTGAGGTGATGATTCCAAGTTCCGACGGACTTAAACCAAAAGACTCATTGTCCCTGGGTAAGGAATGTTCTGATACCAGCAATACCAGAATCGTAAGCCCTGGTGGACAGGGNAACATACAAGCTCCACCTCACAGTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGCCCAGATGGGGNCTTGAAGTCTTCTCCTCCACCTTCCCAAGCCAATCACACATCTCCCCAAATGCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGTCAAATTGGCAAATTTCACAACTGGACAAACGGGGCTTTTCTCACACAGAGCTCTCTGATAAACATGAGATCCTTGTTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCACCAACAATCTACATTGTTAGCAACAAACCTGGGTTCCCTCAGTAGCGACAGAACTCCAGAGAGGNNCAGTCCCAAGCACTCAGACAGAGAAAATTTACCCAGANNCGAATCACCACCTCAGTTAAAACCTTNNTTNNNNGCTGNTCGTGAAAAGACCTTTTCCC
  5   1   2       bld Ga15      in                       XL411n04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGGAGAGCATANATATTGATAANATTGATGACAATCGACGGTGAACAAAGCAACGAGGAAGAGGATGAGAAACTGGACCACTTTAGACATGGCGAGAAAGTAAGTTTGAAAAAGGAGAGTGAGGNGATGATTCCNCGTTCCGACGGACTTAAACCAAAAGACTCATTGTCCCTGGGNAAGGAATGTTCTGATACCAGCAATACCAGAATCGTAAGCCCTGGTGGACGGGGCAACATACAAGCTCCACCTCACAGNNNACCAANAATCTGGTCCTTGGCNNAANCNGCNACNNGCCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCCCNGGCCAATCACACNTCTCCCCAAATGCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGTCAAATTGGCAAATTTCACAACTGGACAAACGGGGCTTTTCTCACACAGAGCTCTCTGATAAACATGAGATCCTTGTTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCACCAACAATCTACATTGTTAGCAACAAACCTGGGTTCCCTCAGTAGCGACAAAACTCCAGAGAGGACCAGTCCCAAGCACTCAGACAGAGAAAATTTACCCAGAACCGAATCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGACCTTTTCCCAACAGAAGGCACCTCTCGTATACTGACAGCA
  3   1   2       bld DMZ       in                         xl313p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGAAAATGTACTCAATCTAAGTCCCTCGACCTCTGGTGCAGTTAAACGACACCCACAATCCCAATGGCTACAATTGTTTCTGGAAACAGTGGTAGTTGAAGTTAAGTTACAATTTAGCTGCAGATTTGCCAGTAGTCCTGATACAGGCAAGCTAGCACTGACTGTGATTGAGATAAGGTCAAGAGAGAAATAAATATCAGCTGGCCACCAAGCACTTGCTGCCGAGTGTTTCTGTTATTTCAACTGATGTCTTGTTTTCTTCACAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGTAAGTATTCATCGGAAACAAAGAAAAAAATGCAAAGATGAACCATGTTATTAATTTTTAAATCTCTAATTGTTATCTCTTTCTTCCTTCCAGCACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTGT
  5  -1   2       bld Bla2                            IMAGE:7297562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGCACTACAGTAACAAAATCTGTCTNGCAGAACAGCACAGCCCAGATGGGCCTGAGTCTTCTCTCCCACCTCTCAGGCAATCACACATTCCCCCAATCCAGCACCCAGCCTTCTACCCAGCCATGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTCCTNCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCATATATTTTTGTCTAATAAACTAAATGAAATTATGaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTATGAGCGGTT
  3   1   2       bld DMZ       in                         xl286l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGGCTACAATTGTTTCTGGAAACAGTGGTAGTTGAAGTTAAGTTACAATTTAGCTGCAGATTTGCCAGTAGTCCTGATACAGGCAAGCTAGCACTGACTGTGATTGAGATAAGGTCAAGAGAGAAATAAATATCAGCTGGCCACCAAGCACTTGCTGCCGAGTGTTTCTGTTATTTCAACTGATGTCTTGTTTTCTTCACAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGTAAGTATTCATCGGAAACAAAGAAAAAAATGCAAAGATGAACCATGTTATTAATTTTTAAATCTCTAATTGTTATCTCTTTCTTCCTTCCAGCACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTGTCAAAGCA
  3   1   2      seed DMZ  5g3  out                        xl315l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCACCTTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACT
  3   1   2       bld DMZ  5g3  out                        xl321p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTCAAGGCAATCACACATCTCCCCCAATCCAGCACCCAGCCTTTCTACCCAGCCATGGACTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACT
  3   1   2       bld DMZ       in                         xl287l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGGAAACAGTGGTAGGTGAAGTTAAGTTACAATTTAGCTGCAGATTTGCCAGTAGTCCTGATACAGGCAAGCTAGCACTGACTGTGATTGAGATAAGGTCAAGAGAGAAATAAATATCAGCTGGCCACCAAGCACTTGCTGCCGAGTGTTTCTGTTATTTCAACTGATGTCTTGTTTTCTTCACAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGTAAGTATTCATCGGAAACAAAGAAAAAAATGCAAAGATGAACCATGTTATTAATTTTTAAATCTCTAATTGTTATCTCTTTCTTCCTTCCAGCACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTG
  3   1   2       bld Ga12 5g3  out                        XL191j01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCAGCACCCAGCNTTTNTTACCCAGCCATGGANTATACACGTGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTCCTCACACCAGAGCTCTNTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACNTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTCATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTGTCTAAAGCA
  3   1   2       chi Neu7                                 XL047i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTATACACATGTCAAATTGGCAAATTTCACAACTGGACAAACGGGGCTTTTCTCACACAGAGCTCTCTGATAAACATGAGATCCTTGTTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCACCAACAATCTACATTGTTAGCAACAAACCTGGGTTCCCTCAGTAGCGACAGAACTCCAGAGAGGACCAGTCCCAAGCACTCAGACAGAGAAAATTTACCCAGAACCGAATCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGACCTTTTCCCAACAAGAAGGCACCTCTCGTATACTGACAGCACTTCCCTCTGCCTGACGGCTAGAAGAAATTATTAAAGAGCCCTTACCAAAATATGGACAGAACTGGATATTTTATAAATGTCGTCATCCTCTTTTTGCAATAATGTGCTACAAATTCAGACTACCCCGATTTTTTACACATCTTTAGACGGACCCCCCACTTTCCGAGTTTCACTTCAGACTCTGGTCTGATACTTTTTATGTTTCTCAAGTATTTGTTTCATTTTTTCTCTCTTGTATATAAAGTGATCTCAGATTGTAAATAGAGCGCAAGCAAAAACACT
  3   1   0       chi Ga15      in                       XL411n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TANACNCATGTCAAATNGGNAAATTTCNCAGGTGGNCAAGCGGGGCNTTTCTCACACAGNGCTNTGNGATANACATGAGATCCTNGTTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCACCAACAATCTACATNGTTAGCAACAAACCTGGGTTCCCTCAGTAGCGACAAAACTCCAGAGAGGACCAGTCCCAAGCACTCAGACAGAGAAAATTTACCCAGAACCGAATCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAAGACCTTTTCCCAACAAGAAGGCACCTCTCGTATACTGACAGCACTTCCCTCTGCCTGACGGCTAGAAGAAATTATTAAAGAGCCCTTACCAAAATATGGACAGAACTGGATATTTTATAAATGTCGTCATCCTCTTTTTGCAATAATGTGCTACAAATTCAGACTACCCCGATTTTTTACACATCTTTAGACGGACCCCCCACTTTCCGAGTTTCACTTCAGACTCTGGTCTGATACTTTTTATGTTTCTCAAGTATTTGTTTCATTTTTTCTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGAGCGCAAGCAAAAACACTT
  3   1   2       bld Ga12 5g3  out                        XL168f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCACAACTGGACAAACGGGGCCTTCNTCACACAGAGCTCTNTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCAT
  3   1   2       bld Ga12 5g3  out                        XL141p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCACACAGAGCTCTCTGATAAACATGAGGTCCTTGTTGGGTGTAAACCCGCACCATGCGGCTCACCATAACCACCACCACCTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTCATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACNTGTGTAAAG
  3   1   2       bld Ga12 5g3  out                        XL219i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGTTCAGGCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTCATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCA
  3   1   2       bld Ga12      in                         XL174g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCATCAACAAGCTCCATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTATTTTTCTCTCTCTCTGTGTATATATAAAGNATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTNTCTAA
  5   1   2       bld Ga12      in                         XL174g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTTTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCATATATTTTTGTCTAATAAACTAAATGAAATTATGaaaaaaaaaa
  3   1   2       bld Tbd7 5g3  out                        XL056e13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGTTCCCTCAGCAGCGACAAAAACTCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCACCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACTGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGTAAAAACTAACCCTGGTCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTAATTTTTCTCTCTCTCTGTGTATATATAAAGTGATCTCAGAATGTAAATAGCGCGCAAGCAAAAACTTGTCTAAAGCATA
  3   1   2       bld Ga12 5g3  out                        XL176d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCAGAACGGACCAGTCCCAAGCACTCAGACAGAGAAAATGTACCCAGAACCGACTCGCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCTCAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTGGAAGCAATGATAAAAGAGCCCTTACCAAAATATGGACAGAACTGGGTATCCTATAAATGAATCCAACCCTCTTTTTGCAATAATGTGCTACACGTTCAGACNGCCCAATTTTTACTTATCTCTAGACGGATCCCCCATTTTCCGTGTTCCATTTCAGACCTTGAAAAANCGTAACCCTGGTCGGACATTTTTCATGTTTCCCAAGTATTTGTGTTTAATTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)