Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6956756.3                       7 PI      83       1738     2151                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012772275 Xl3.1-IMAGE:3401469-IMAGp.5 - 35 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3401469-IMAGp.5  AGATTATTCTATTAATACAGAGCCTGTAAATACATTTTTTTTTCTCCTTTTTTTTTGTTTGACTTGGTCTCAGATTGTTGTGTTTTGCCATGGATTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTCTTCACAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGTGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGTGTGTGTTATATAAACAAGCTACTGTGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTCTATAGACCCGACCTACCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAGCCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCACAGGATACACAGCAGAAAACAGTTAAGCTCTGTAGTCTTACAATGGGATTGTTCACAACTTATCTGTTATCTACTGTGTTCCCTGTGTTTGAATGACTACACAGCACTACATTATATTGTCATTCTATTAAAACACTTGCATTTTTTGGTGTTACTGTTCCAATAAGGGTAATGTTAGCACCCATGCGATTTCTAGCTCAAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCACCTGCCATTGCTTTACAAGTAATATGATACTTCATCTGAGGGTTTGCTGTTCTACAACTAATTCCCTGCCAAAGATTTCAGCTGGCATAAAGGGTAGCGTTGTGTTATGGCTGGGTCTTGGGTAACCTCCAGCCCTGGTTTGATTGAATAGTGGTTGAGTTGAGGGAGTGGTTTTGAGGGTTGTCATGGCAAGGTTTTGATTGGTGCAACCATACAGCAGGATTGTTCAATAGTACGTCCCATTAGCTTCAAGGTGCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687589        TTCTATTAATACAGAGCCTGTAAATACATTTTTTTTTCTCCTTTTTTTTTGTTTGACTTGGTCTCAGATTGTTGTGTTTTGCCATGGATTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTCTTCACAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGTGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGTGTGTGTTATATAAACAAGCTACTGTGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTCTATAGACCCGACCTACCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAGCCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCACAGGATACACAGCAGAAAACAGTTAAGCTCTGTAGTCTTACAATGGGATTGTTCACAACTTATCTGTTATCTACTGTGTTCCCTGTGTTTGAATGACTACACAGCACTACATTATATTGTCATTCTATTAAAACACTTGCATTTTTTGGTGTTACTGTTCCAATAAGGGTAATGTTAGCACCCATGCGATTTCTAGCTCAAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCACCTGCCATTGCTTTACAAGTAATATGATACTTCATCTGAGGGTTTGCTGTTCTACAACTAATTCCCTGCCAAAGATTTCAGCTGGCATAAAGGGTAGCGTTGTGTTATGGCTGGGTCTTGGGTAACCTCCAGCCCTGGTTTGATTGAATAGTGGTTGAGTTGAGGGAGTGGTTTTGAGGGTTGTCATGGCAAGGTTTTGATTGGTGCAACCATACAGCAGGATTGTTCAATAGTACGTCCCATTAGCTTCAAGGTGCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAxTxxxxTTTxxATTTTTTAATAAAGTGTCTAAGAGTAAAAAAAAAAA
                                                      consensus depths       3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     6     5     6     6     6     6     6     6     6     5     6     6     6     7     7     7     7     7     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     4     5     3     5     4     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     5     6     6     7     6     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     7     7     7     7     7     7     7    11     7    11     7    11     8    11     6    11     8    11     8    11     7    10     6     9     6     9     6     9     6     9     6     9     6     9     7    11     6    13     7    14     8    14     8    14     7    15     7    15     7    15     7    15     8    15     7    16     7    16     7    16     6    16     6    16     7    17     9    17     9    18    14    19    17    19    17    20    17    20    17    20    18    20    18    21    18    21    16    22    18    22    19    22    20    23    21    23    20    23    21    22    21    22    20    22    21    22    21    22    20    22    20    22    20    21    20    21    20    21    20    21    18    21    12    21    12    21    12    21    12    20     8    17     6    14     6    10     4     7     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGTTTATACTATTGAAATCATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAAGTTGCAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATATATACATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCAGAATTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
  5   1   2       bld Tbd7      in                         XL098j08.5p GAGATTATTCTATTAATACAGAGCCTGTAAATACAtttttttttctcctttttttttGTTTGACTTGGTCTCAGATTGTTGTGTTTTGCCATGGATTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTNTTCACAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGNGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGNGNGNGTTATATAAACAAGCTACTGNGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTNTATAGACCCGACCTACCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTNTGAGGTCGGCCTGAC
  5   1   2       bld Tbd7      in                         XL059c05.5p  AGATTATTCTATTAATACAGAGCCTGTAAATACAtttttttttctcctttttttttGTTTGACTTGGTCTCAGATTGTTGTGTTTTGCCATGGATTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTCTTCACAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGTGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGTGTGTGTTATATAAACAAGCTACTGTGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTCTATAGACCCGACCTACCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGGAGCGTCTGAGGTCGGCCTG
  5   1   2       bld Tbd7      in                         XL109h21.5p  AGATTATTCTATTAATACAGAGCCTGTAAATACAtttttttttctcctttttttttGTTTGACTTGGTCTCAGATTGTTGTGTTTTGCCATGGATTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTCTTCACAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGTGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGTGTGTGTTATATAAACAAGCTACTGTGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTCTATAGACCCGACCTACCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAACCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGC
  5   1   2       bld Ga12      in                         XL215j15.5p                                                                                                TTAGGAAGGAAGAAGTCATTCTCTTTATAGTACTGGGAATCTTTTTGTAAGGGATGGAGAGTAAAGGAGAAGGGAGCAGGCAGTTGCAGCAGACAACGGCTCAGGTCACCATCAGCTGCTCTTCATAAGGAAGCTACAGTTTTGCTGCTGGGAAGAGCTGCCACAGCCTTAAAGGAATAGTAACACCAAAATATTGTAGTGTTTTAAAGTAATGAAAATATAATGTACTGTTGCCCTACACTGGTAAAACTGGTGTGTGTTATATAAACAAGCTACTGTGTAGCCATTAGTGTGTGCGGGTCGGACTTTTCCCAAGCCCGACTTCTATAGACCCGACCTGCCGATGATGAAACAAAAGGGGAGGGGTGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAGCCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCAC
  5   1   2       bld Brn1                            IMAGE:6951634.5p                                                                                                                                                                                                                                                                                                                                                                                                             TAGGACTTTTCCCAGCCCGACTTCCATAGACCCGACCTGCCGATGATGAAACAAAAGGGGAAGGGCGAGAGGTCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGATGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAGCCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCACAGGATACACAGCAGAAAACAGTTAAGCTCTGTAGTCTTACAATGGGATTGTTCACAACTTGTCTGTTATCTACTGTGTTCCCTGTGTTTGAATGACTACACAGCACTACATTATATTGTCATTCTATTAAAACACTTGCATTTTTTGGTGTTACTGTTCCAATAAGGGTAATGTAAGCACCCATGCGATTTCTAGCTCAAGGATGGGCGCTAGAAACGACCCCTGACCTTAAGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCCGGATTACCACGCAGGCATCAATTGCTTCAGCTGCCATTGCTTTTCAAGGTAAATGATACTTCATCTGCAAGGTTTGCTGGTCCTACCCACTAAATTCCCTGCCCAAAGAATTTCAGCTTGGGGTAAACGGGTAACGGCTGTGTTTAAGGCCTGGGGTCTTTGGGTTATCCGTCCCACCCCCTGGATTTTGATTCGAATTCCCTGGTTTTGAATTTTAGGAGAAGTGCGTTTTAGAGGGGTTTGCTCATGACTAAGGGTTTTTGGATTTGGGTGTGCACTCTTAAGCCCTCAAAGATTTGGATGTAATTAGTTAccccccccAATTGAAGCTTCACCGGGGGAGTCCCACCCGGAGTGTTACCCCACAATAGAATTTTTTGCCCCAGAAATAAAAATTGATTGTGCCATTTATAGCCTGCAGAGTTTAGACGGGTAGAAAGGGAAAGCCCATTTATCTAGG
  5   1   2       bld Ga18      in                      xlk124b15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                             TCNNNNNTTCCCAAGCCCGACTTCTATAGACCCGACCTGCCGATGATGAAACAAAAGGGGAGGGGTGAGAGGNCAACGTCTATAAAAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAGCCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCACAGGATACACAGCAGAAAACAGTTAAGCTCTGTAGTCTTACAATGGGATTGTTCACAACTTATCTGTTATCTACTGTGTTCCCTGTGTTTGAATGACTACACAGCACTACATTATATTGTCATTCTATTAAAACACTTGCATTTTTTGGTGTTACTGTTCCAATAAGGGTAATGTTAGCACCCATGCGATTTCTAGCTCAAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCNCCTGCCATTGCTTTACNAGNAANNNGATACTTC
  5   1   2       bld Oo1       in                    IMAGE:3403994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAACTCAACACGGAAACCGGCATTTGCGACCCGGAAAGGAGCGTCTGAGGTCGGCCTGACGCGTGGGTATCTGGTCGGCCCACACATCACTAGTAACCATGGGGGCAGCCATTGAAAGCTGAAAAAGGAGAAAAAGCACAGGATACACAGCAGAAAACAGTTAAGCTCTGTAGTCTTACAATGGGATTGTTCACAACTTATCTGTTATCTACTGTGTTCCCTGTGTTTGAATGACTACACAGCACTACATTATATTGTCATTCTATTAAAACACTTGCATTTTTTGGTGTTACTGTTCCAATAAGGGTAATGTTAGCACCCATGCGATTTCTAGCTCAAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCACCTGCCATTGCTTTACAAGTAATATGATACTTCATCTGAGG
  5   1   2       bld DMZ                                  xl276d18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTCTAGCTCAAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTCTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCACCTGCCATTGCTTTACAAGTAATATGATACTTCATCTGAGGGTTTGCTGTTCTACAACTAATTCCCTGCCAAAGATTTCAGCTGGCATAAAGGGTAGCGTTGTGTTATGGCTGGGTCTTGGGTAACCTCCAGCCCTGGTTTGATTGAATAGTGGTTGAGTTGAGGGAGTGGTTTTGAGGGTTGTCATGGCAAGGTTTTGATTGGTGCAACCATACAGCAGGATTGTTCAATAGTACGTCCCATTAGCTTCAAGGTGCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCCGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTTGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTG
  5   1   2       bld Tail      in                    IMAGE:8542333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCAGGATGGGTGCTAGAAACGACCCCTGACCTTAGGGGACATGCACATACGTCACAGTAGTTTTTTATGGTGGTCTATGCAGGATTACCACGTAGGCATCAATAGCTTCACCTGCCATTGCTTTACAAGTAATATGATACTTCATCTGAGGGTTTGCTGTTCTACAACTAATTCCCTGCCAAAGATTTCAGCTGGCATAAAGGGTAGCGTTGTGTTATGGCTGGGTCTTGGGTAACCTCCAGCCCTGGTTTGATTGAATAGTGGTTGAGTTGAGGGAGTGGTTTTGAGGGTTGTCATGGCAAGGTTTTGATTGGTGCAACCATACAGCAGGATTGTTCAATAGTACGTCCCATTAGCTTCAAGGTGCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTATTCTATATGAATTGACAACCTCTTTCTTCTGTTNATGTGATAATGCAACTGTCATCTACCGTAANGGCGATATTNGTATTATACTGGAATTCGATTTTCAGCTTCACGTCACAGCATGTCTCACTTACATGTAACATGAACATTGCGCG
  5   1   2       bld Egg1                               PBX0080B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGGGAGTGGTTTTGAGGGTTGTCATGGCAAGGTTTTGATTGGTGCAACCATACAGCAGGATTGTTCAATAGTACGTCCCATTAGCTTCAAGGTGCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAATCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTTCTAATTCTATATGAATTGACAACCTCTTTCTTT
  5   1   2       bld Ga18      in                      xlk152h24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTNCTCTCTGAGTTTATACAAATAAATTGCGCCAAATAACCTGCTGCATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAtttttttttgttttttttttNCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTANCCCATGTGTGAGTCTGTAGCGTTTCTNCATGTCGGGGGGAGATNNGGGTGGAGTTAGTGANANCTCTGCTTGACACAAGGNTTNGGTggggaagggggggNNNAATNNAGATTNACNATNTCTNGNAA
  5   1   2       bld Skin                            IMAGE:8642635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTAACTGAATTAACTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAtttttttttgttttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACANGGCTGGGTGGGGAAGGGGGGCGTATGCAGATTACTACTCTGGAACATATACAGTGCTCGACTTTATACACCTGGCATACAATACACTTAATAAGCTGTTATATGTTGTTATGATGAGTATAGTGGACATTAAGCAGTTATCC
  5   1   2       bld Egg1                               PBX0083A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCATCTCTAGCCTATCAGGGCCTTTTCATTTCTAGCTGAATATGTTCACATCCAATAAAGCATCTTCCTTTCACACATAACCTTCCATGTCATTCTCTGTGCTGGGTTTGCTGGCTGAGGATTGCAGTTTATTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCTAGCTTTCCACTGTCCACAGGCAGTGTCGTCGACTTTACATTGGTTATACTATTGAAATCATTTGCT
  3   1   2       bld Tail      in                    IMAGE:8542333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTCATTTCTAGGCTGAATATTGTTCACATCAATAAAGCATCTTCTTTCACACATAACTGCATGTCATCTCTGTGCTGGGTTTGCTGCTGAGATTGCAGTTTATTTTATGGGAGCAGAAGCAACTCCCTGTACTCCTAGCATAGTGCTGAAACACCAGTGCAATCGTTCCATGCATTTAGTTTCTTCTCCTAATTCTATATGAATTGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGTTTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATGCTCATGTCTACATCAAGGAG
  5   1   2      seed Emb1                   IMAGE:3401469-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTCTGTTTATTGTGATAAATGCAAAGAAAGAGGTTGTCAATTCATATAGAATTAGGAGAAGGAAACTAAATGCATGGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAtttttttttggtttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTtgggtggggaagggggggCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTccccccccccTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTaaaaaaaaaaaaaaa
  5  -1   2       bld Em10                            IMAGE:7979534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTGCGTTTAGGAGGAGAATCTGTATCTGATATGTGACACAGGCATGTTCAGCATAGTTCTTTCCTATTTAAGAATGAAACTCTTTCTCTGTTATGTGAAATGCAAATGTCTCCTACCGTAGGCGGATATTTGTATTATACAGGGAATTCGATTTTTCGAGCTTCCACGGTCCACAGGCAGTGTTGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAAttttttttgtttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTTTGCTTGACACAAGGCTTGGGTggggaagggggggCGTAATGCAGATTTACTATTTTTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTcccccccccccTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTATACAAGaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Emb1      in                    IMAGE:3401469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGTTTATTGTGATAAATGCAAAGAAAGAGGTTGTCAATTCATATAGAATTAGGAGAAGGAAACTAAATGCATGGACAACCTCTTTCTTTCTGTTTATTGTGATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATAATTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAtttttttttggtttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTC
  3   1   2       bld Ga18      in                      xlk124b15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGNATAGTNNTGAANCNCCAGTGNAATCNTTNCNATGCATTTAGTTTCCTTCTCCTAATTCTATATGAATTGACANCCTCTTTCTTTCTGTTNATTGTNATAAATGCAAACTGTCATCCTACCGTTAAGGCGGATANTTTGGTATTTATACATGGGAATTTCGATTTTTCGAGCTTTCCACGGTCCACAGGNAGTGTCGTCGNNTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATNCCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACNCCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAANTNA
  3   1   2       bld Ga18      in                      xlk165j07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTCGANCTTTCCACGGTCNACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAANANANACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGGTTTTTTTTTCTTNGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATANCTCATTTGTAAANTCA
  5   1   2       bld Ga18      in                      xlk165j07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTCGAGCTTTCCACGGTCCACAGGCAGTGTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAtttttttttggtttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTtgggtggggaagggggggCGTAATGNAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTccccccccccTTTTTGTACAGAGAAAACAAATATTGTAGNTTATAACTCATTTGTAAAATCNANTACATTTTCATTTTTTAATAAAGNGTCTNAGA
  3   1   2       add Ga12      in                         XL215j15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGCAGTGTNGTNGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTTTGCTTTGTAAGTTGCAGTTTTTCAATGGGGATCAGTTTGTTTTTGAGCAGGAAGTTTTGTTTTTTAAATGGNGAAGATTATTTNCAGTATAAAGGGNGGGTACATNCCAGCAANATATACATGTGGTGGTTGGTAAAGCAGAAATTTTTTTTGTTTTTTTTNTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTNCCCCATGTGNGAGTNTGTAGNGTTTTTCCATGTNGGGGGGAGATGCGGGTGGAGTTAGTGACNCCTTTGCTTGACNCAAGGCTTGGGTGGGGAAGGGGGGGNGTAATGCAGATTTACTATNTTTGGGAACATTATAACAGTGCCTNGACCTTTATTAACNCNCTGGCAATAACAAATACNCCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAANGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTCCCCCCCCCCCTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCAT
  3   1   2       bld Tbd7      in                         XL109h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCGTCGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTNTGCTTTGTAAGTTGCAGTTNTTCAATGGGGATCAGTNTGTTTTTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATANACATGTGGTGGTTGGTAAAGCAGAAATTTTTTTTGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTCCCCCCCCCCTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGT
  3   1   2       bld Tbd7      in                         XL059c05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGACTTTACATTGTTTATACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTNTGTTTNTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATANACATGTGGTGGTTGGTAAAGCANAAATTTTTTTTGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTCCCCCCCCCCTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCANTTT
  3   1   2       bld Tbd3                            IMAGE:3549208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTATTGAAATCATTTGCTGTCTGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTGTTTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTTCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTCATTTTTTAATAAAGTGCCTAAAAGTTAAA
  3   1   2       bld Egg1                            IMAGE:4783674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTTTGTAAGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCTTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTAAAAAAAA
  5   1   2       bld Egg1      in                    IMAGE:4678290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCACGAGGTTGCAGTTCTTCAATGGGGATCAGTCTGTTTCTGAGCAGGAAGTTTTGTTTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAAttttttttttttttttCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTtgggtggggaagggggggCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTcccccccccTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAG
  3   1   2       bld Egg1      in                    IMAGE:4678290.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTAAATGGAGAAGATTATTTCCAGTATAAAGGGCGGGTACATACCAGCAATATATACATGTGGTGGTTGGTAAAGCAGAATTTTTTTTTTTTTTTTCTTTGTGGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCTTTTTGTACAGAGAAAACAAATATGCTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd7      in                         XL098j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGGTTGGTAAANCANAAATTTTTTTTGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGANATGCGGGTGGAGTTAGTGACACCTCTGCTTGACAAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTCCCCCCCCCCTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTNAAAATCAATTACATTTTCANTTTT
  3   1   2       bld Oo1       in                    IMAGE:3403994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATTTTTTTTGTTTTTTTTTCTTTGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTCCCCCCCCCCTTTTTGTACAGAGAAAGCAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTATAAAAAAAAAAAAAAAA
  5  -1   2       chi DMZ       out                        xl308d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ttttttttttCTTAGTCGTCATTTTTGTAAGTAGACAAGAGCATGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTNCTTGACACAAGGCTTGGGTggggaagggggggCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGANGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTcccccccccTATTTGTTTTCTCTGTAC
  3   1   2       bld Ga18      in                      xlk152h24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNGNAANAANANAAGANNCANGTTACCCCATGTGTGAGTCTGTAGCGTTTCTCCATGTCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAA
  3   1   2       bld Emb1      in                    IMAGE:3401469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGGGGGAGATGCGGGTGGAGTTAGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTAA
  3   1   2       bld Gas5                            IMAGE:3747780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGGAGATGCGGGTGGAGTTTGTGACACCTCTGCTTGACACAAGGCTTGGGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGAAAGTTTCATTTCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAAAGTGTCTAAGAGTTAAAAAAAAAAAAAAAATTAA
  5   1   2       bld Ooc1      in                      xlnoc002j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAGTGACACCTCTGCTTGACACAAGGCTtgggtggggaagggggggCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTTccccccccccTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTTTCATTTTTTAATAA
  3   1   2       bld Ooc1      in                      xlnoc002j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGGGGAAGGGGGGGCGTAATGCAGATTTACTATCTCTGGGAACATTATAACAGTGCCTCGACCTTTATTAACACACTGGCAATAACAAATACACCTTTAAATAAAAGCTGTTTTATAATGTTTTGTTTTAATGAATTGATGTAATAATGTTGGAAACCATTTTAAAGGCAAGTTTCATTTCCCCCCCCCCTTTTTGTACAGAGAAAACAAATATTGTAGTTTATAACTCATTTGTAAAATCAATTACATTCTCATTTTTTAATAAAGTGTCTAAGAGTTATACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)