Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl315l15.3                           22 END     8          40       36                homeobox Iro protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012773546 Xl3.1-xl315l15.5 - 20 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl315l15.5                    CTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTTCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGGCAGCAGCAGCAGCGGCCGCAGCAGCAGCAGCCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAATTCCAGTAT
                                                  Xl3.1-CHK-1012690003                          TGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTTCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGGCAGCAGCAGCAGCGGCCGCAGCAGCAGCAGCCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAATTC
                                                      consensus depths                         6     7    10    10    10    12    10    13    10    16    10    17    12    17    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    14    18    14    17    14    17    14    17    14    17    14    17    13    17    11    17    12    17    12    17    11    16    11    16    10    16    10    16     9    15     9    15     9    14     8     9     8     8     8     8     8     8     8     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     5     5     5     5     5     5     5     5     4     4     2     3
                                               BLH ATG     324     180                    
                                               BLH MIN     324      43                    
                                               BLH MPR     324      43                    
                                               BLH OVR     324     320                    
                                               CDS MIN     324      43                    
                                               EST CLI     -12      15                    
                                               ORF LNG     324       4                    
                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 8e-021     XP_544403.2 PREDICTED: similar to Iroquois related homeobox 3 [Canis familiaris] ====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-037     NP_997068.1 iroquois homeobox protein 1, a isoform 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-049     NP_077313.3 iroquois homeobox protein 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-050     NP_034703.2 Iroquois related homeobox 1 [Mus musculus] ==============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Bt ==== 4e-050     XP_001251877.1 PREDICTED: similar to homeodomain protein IRXA1 [Bos taurus] =========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 1e-056     NP_001025509.1 iroquois homeobox protein 1 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 1e-066     AAT72003.1 iro1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 2e-067     NP_001081649.1 homeobox Iro protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl315l15.5                             TGA------------TAA------TAG---------------------TGA------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Ga18 5g                             xlk6f15ex.5p GCAGACACATCAGTTGGAGCTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGNTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGNNNGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGNCTACCCCCAGTACCTGACCGCCGGCNAGNTGCAGTCTATGGAGGCGAACGGNCGGGNNGTTTTGGCCGCGNNNNNNCAGCA
  5   1   2       bld Brn2                             Brn2-za50e10.5p        GATCAGTTGGAGCTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTCTTAGATCAATTTTTA
  5   1   2       bld Ga18 5g                           xlk118o15ex.5p         ATCAGTTGGAGCTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGNCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGNTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCtttttttcttagatcaatttttacctcccctttaagataccctttttCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGNGNNNCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGNCTACCCCCAGTACCTGACCGCCGGCCAGNTGCAGTCTATGGAGGCGAACGGNCGGGCGTTTTGGCCGNNNNGNNCAGCAGCNGC
  5   1   2       bld Ga18 5g                             xlk5h06ex.5p         ATCAGTTGGAGCTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGNTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCtttttttcttaagatcaatttttacctcccctttaagataccctttttCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGNNNNNCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGNCTACCCCCAGTACCTGACCGCCGGCCAGNTGCAGTCTATGGAGGCGAACGGNCGGGCGTTTTGGCC
  5   1   2       bld Gas4 5g                IMAGE:3420567-IMAGp.IMAGp           TTTCCCGGGGGAATTGTTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGGCAGCAGCAGC
  3   1   2       bld Gas4      in                    IMAGE:3420567.3p                  CCGGGAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTTCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATG
  5   1   2      seed DMZ  5g3  out                        xl315l15.5p                    CTCAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAATTCCAGTATGGAG
  5   1   2       bld DMZ  5g3  out                        xl321p11.5p                      CAATTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAATTCC
  5   1   2       bld Ga18 5g                           xlk122m15ex.5p                         TTGTTGATCAGATCACATCTAAGGGATTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGNCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGNTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGNNNNNCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGNCTACCCCCAGTACCTGACCGCCGGCCAGNTGCAGTCTATGGAGGCGAACGGCCGGNCGTTTTGGCCnnnnnnnnCAGCAGNNNCNNAA
  5   1   2       bld Ga18 5g                           xlk105p05ex.5p                               ATCAGATCACATCTAAGGGANTTAGAAGCACAGAAGAGCAGAGATTTGAGGGGNCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGNTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGNNNCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGNCTACCCCCAGTACCTGACCGCCGGCNANNTNCAGTCTATGGAGGCGAACGGNCGGNCGTTTTGGCCNCNNNNNNCAGCAGCGGCGC
  5   1   2       bld Tbd7 5g3  out                        XL056e13.5p                                     GATACATCTAAGGGATTTAGAAGCACAGNAAGAGCAGAGATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCgcttctttttttctaagatcaatttttacctcccctttaagataccctttttCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGGCAGCAGCAGCAGCGGCCG
  5   1   2       bld Gas4      in                    IMAGE:3420567.5p                                       ACATCTAAGGATTTAGAAGCACANAANAGCAGAGATTTGAGGGGGCTNAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAG
  5   1   0       chi Ga18                                xlk6p22ex.5p                                              ANNNTTCAGAAGCACAGAAGAGCAGAGATTTGAGTGGGCTAAAAAAACATCCTGAGACACCCTGACGAATGCACACACCTTGTCCCTTATTCGTATCCGAGCTTCCTCTGTAAAACGCGCGCACTGTGGGAGAGGGANTCCGTGGCTGAATCCATTTTTTTCTTACATCAGTTTTTAccccccccccccTGAAGANANATTTTCNC
  5   1   2       bld Ga12 5g3  out                        XL168f11.5p                                                  AGGGATTAGAAGNCAGAAGAGCAGAGATTTGAGGGGGCTAAAAAACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCCCTTCttttttttCTTAAGATCAATTTTTACCTCCCCTTTAAGATAACCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAA
  5   1   2       bld Ga12 5g3  out                        XL141p20.5p                                                                TGCAGGGNAGNATTTGAGGGGGCTAAAAAACACCCTGNNACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGcttctttttttcttaagatcaatttttacctcccctttaagataccctttttCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCC
  5   1   2       bld Em10                            IMAGE:7982871.5p                                                                   CAATTGTTGATCAGATCACATCTAAGGGATTCAGAAGCACAGAAGAGCAGAGATTTGAGTGGGCTAAAAAAACATCCTGAGACACCCTGACGAATGCACACACCTTGTCCCTTATTCGTATCCGAGCTACCTCTGTAAAACGCGCGCACTGTGGGAGAGGGACTCCGCGGCTGAATCCATTTTTTTCTTACATCAGTTTTTAccccccccccccccTGAAGACATATTTTCACCAACCCTTCTGTGCTTGCTGTTGTGCACGCAGTGGCAGCGATTCCCCTGCTGGAGAGACATGTCCTTCCCGCAGCTGGGTTACCCCCAGTACCTGACCGCCGGCCAGGGTGCAGTCTATGGCGGCGAACGGCCGGGCGTTTTAGCCGCGgcagcagcagcagccgcagcagcCGGAAGGCCAACAGGAGCTGAGCTGGGCAGCTGTCCTACCGCGGCAGTCACCTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCTCTCCCAACTACAGCGCCTTTCTGCCATACACAACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAACCCTGGTGTCCACCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAGTTCAGTATGGAGACCCAGGGCGGCCAAAGATTGCTACAAGGAGAGCACCAGCACCTAAGGCTTGGCTCACGAGCACGAAGACCCTTACCCACCAGGTGGAGAGAC
  5   1   2       bld Ga12 5g3  out                        XL191j01.5p                                                                           ATTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAATTCCAGTATGGAGAC
  5   1   2       bld Ga12 5g3  out                        XL219i07.5p                                                                            TTTGAGGGGGCTAAAAAACACCCTGAGACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTCTTTTTTTCTTAAGATCAATTTTTACCTCCCCTTTAAGATACCCTTTTTCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGCCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCAGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGTGT
  5   1   2       bld Ga12 5g3  out                        XL176d11.5p                                                                                                       ACACCCAAACGAATCCACACACCTCGTCCCTTTCTGTTATCCGAACTCCCTCTGTACAACGCGCGCACAGTGGGAGAGAGACTGCGAGGCTGTTGCTCACTTTTTGGCCCCATCCTTGGCCAATCCGCTTctttttttcttaagatcaatttttacctcccctttaagataccctttttCACCAACCCTTCTGTACTTGCTGTTGTGCCCGGAGTGGCAGCGATTTCCCTGCCGGAGAGACATGTCCTTCCCGCAGCTGGGCTACCCCCAGTACCTGACCGNCGGCCAGGCTGCAGTCTATGGAGGCGAACGGCCGGGCGTTTTGGCCGCGgcagcagcagcagcggccgcagcagcagcagcCGGATCCGGAAGGCCGACAGGAGCTGAGTTGGGCANGCAGTTCTACCGCGGCAGTCACTTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATNTNACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAATCCTGGT
  5   1   2       bld DMZ                                  xl270d18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCANTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)