Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL056l03.5                            3 PI      88       1082     1224                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012774292 Xl3.1-IMAGE:6952207.5 - 15 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6952207.5                          GCTGCACATTGAACAGATCTGTCTGAATATAGCTTTGCTTCAACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAATACAAGCCCCTTTGCACACCAGGCTGGGGTTGTTCATCTTTGAGTTAACTTTTAGTATGATGTAGAGCGTGATATTCTGAAAAACTTCACAATTGGTTTTTATTTTTTATTACTTGTGGTATTTGAATTATTTAGCTCTTTATTCAACTGCTCTCCAGTTTGCAATTTTAGCAATTTAGTCTAAATTACCCATGCACTGATTTGCATAAGAGACAGGAATATAAATAG
                                                  Xl3.1-CHK-1012691814                                CATTGAACAGATCTGTCTGAATATAGCTTTGCTTCAACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAATACAAGCCCCTTTGCACACCAGGCTGGGGTTGTTCATCTTTGAGTTAACTTTTAGTATGATGTAGAGCGTGATATTCTGAAAAACTTCACAATTGGTTTTTATTTTTTATTACTTGTGGTATTTGAATTATTTAGCTCTTTATTCAACTGCTCTCCAGTTTGCAATTTTAGCAATTTAGTCTAAATTACCCATGCACTGATTTGCATAAGAGACAGGAATATAAATAGGAGAGG
                                                      consensus depths                               3     6     3     6     3     7     3     7     5     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    11    11     9    11    11    11    11    11    11    11    11    11    10    12    12    13    11    13    12    13    12    13    11    13    11    13     9    13     8    13     9    13     7    13    10    13    10    14    10    14     7    13     6    13     5    13     4    14     5    14     4    13     5    11     2     9     3     9     2     9     2     9     3     8     3     8     3     8     3     8     3     8     3     8     3     6     3     6     3     6     4     6     3     5     2     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     5     2     5     3     5     2     4     2     4     2     4     2     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---G--------
                                               BLH ATG     167     858                          
                                               BLH MIN     167      99                          
                                               BLH MPR     164      99                          
                                               BLH OVR     152     715                          
                                               CDS MIN     152      99                          
                                               EST CLI     -19       1                          
                                               ORF LNG     152      74                          
  5   1   2       bld Brn1 5g                         IMAGE:6952207.5p CAAATTGAAAGGAGTGGCACATACTGAGGCTGTCCCAGGGGGGAGGCAATGCAGCTAGAGGAATGCCACAGCTCCTGGATACACTCAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATATTTGGCTACAAGGAGCGTGTGGCAAGAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGANATATGGCCAACGGCTGCCTCTGAACGAACTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAAAGTTCATGGGGCGCCCGGGTTTCCGAGCCACGAAACTTGCATTCGTATATGGGACATTCACGGGAATGTTTTCATTCGAGGGGGGACAAAAGATGGGGGGAACTTTCTGTTTGGGACTTTTCCGGACTGAAAACCGTGGGGACTTTTAAGAAAAAATGCCCC
  5   1   2       bld FaBN 5g                         IMAGE:8077844.5p              GGGGTGACTGAGGCTGCACATTGAACAGATCTGTCTGAATATAGCTTTGCTTCAACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAGGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGGAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCACTCTATGGAAGAAAATGCCAACGGCTGCTTCTGACGACTCTGCCTGTCATACGGAGGAGAATCGCA
  5   1   2       bld Int2 5g                         IMAGE:8526487.5p                GGTGACTGAGGCTGCACATTGAACAGATCTGTCTGAATATAGCTTTGCTTCAACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAATGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTNAATTCTTTAAAGCTGCTTGGCACCAGTGGGAGCTACTGATCATTCTGTACGGGTACAGTGGTGGGCACTCTATGAAGAATATGGCNACGCTGCTCTGACGACTCTGCTGTAATACGCAGGAATTCGCAAATCTAGTCATGGCGCCGTTCGAGCCGACTGATCGATAGATCCGATGTCTCAGGGAAAATGGATTGTGACTCACGACTGATAAAA
  5   1   2       bld Te2  5g3  in                    IMAGE:7207099.5p                 GTGACTGAGGCTGCACATTGAACAGATCTGTCTGAATATAGCTTTGCTTCAACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAGAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGGCACTCTATGGNAGAATATGGCNACGGCTGCTCTGACGACTCTGCTGTACATACGCAGAGATTCCAGAGTGCTAGTCATGGCGCCGGTCC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074424.5p                 GGGGTGACTGAGGCTGCCATTGAACAGATCTGTCTGATATAGCTTTGCTTCACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAGGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAATTCTTTAAAGCTGCTGGCACCAGTGNGAGCTACTGATCATTCTGATCGGTACAGTGGTGGGCATCTATGGAGAATATGGCACGCTGCTCTGACGACTCTGCTGTACTACGCAGAATATCCAAATCTAGTCATGGCGCCGTTCAAC
  5   1   2      seed Ov1  5g3  in                    IMAGE:8328459.5p                        CACAGAAAATATAGAGGCAGAGATTGCAGATAAGCTTGTCTTTCCTTCTCCCTTTATTGCAGCAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAGAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTA
  5   1   2       bld Kid  5g                         IMAGE:7012265.5p                                           ATCTGTCTGAATATAGCTTTGCTTCACAGCTGATCCTCCCACACAATGAAAGAATCCAACTGAGCAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAATATGGCNACGGCTGCCTCTGAACGNNACTCTGCTGTACATTACGGCAGGAGATA
  5   1   2       bld Kid  5g                         IMAGE:7010347.5p                                                                                                           CAGTGAAGATCCTCTCTGGGTAGAAAACCTGCTGAGCACGAAAAAAGCAGCTTTGCAGCATTTGAATGAGAAGAAAAGAAATGGATTCCAAGCTGAGATCTTTGCTTTCTGACCACAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAAGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTAAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAA
  5   1   2       add Tad1      in                    IMAGE:6878079.5p                                                                                                                                                                                GGGGAAGAGAAATGGATTCCGGGCTGAGATCTTTACTCTCCGACCACAGCAGATATGTGGAATCATTCCGGCTGTTCCTGCAAAACTCCACAGAGCACCAGTGCATGCAGCACTTTATTGAGACCAAGCTACCCGACATCATCTCAAGTATAGGAAATGACAAGCCGGTGATTGACGTCCTAGGCATTGGAAGTGGATCAGGAGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGAGTCTCCATAAACAACCAGATTGTGGAACCAAGTGCTGAGCAAATCCTTGGCTACAAGGAGCGTGTGGCAAAGGCCCCAAATCTGGGATATGTCACCTTCTCCTGGCATCACCAGACCTCAAGTGAATTTGAACACAGAGTCACTGAAGATAAACAGATGACAAAGTATGATTTTATCCATATGATACAGATGTTATATTATGTAAAGGATGTCCCAGGAACCTTAAAATTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTTGTATCAGGTAACAGTGGGTGGGCCCCACTATGGAAGAAATATGGGCAGCGGCTACCTCTAAATGACCTCTGTCTGTACGTTACTGCGGGAGACATTGCAGAAATGCTTAAGTTCATGGGCGCCCCCGTTCCAGAGTCACGAACTGGCAATCGGAACATGGACATCACTTAATGTTTTCATCGAGGGGGGACTAAAAATGGGGGAAATTTCTTGCTGGGACTTTTCT
  5   1   2       add FaB                             IMAGE:8072867.5p                                                                                                                                                                                                                CCGGATTCCCGGGATAGCAGATATGTGGAATCGTTCCGGCTGTTCCTGCAAAACTCGACAGAGCACCAGTGCATGCAGCACTTTATTGAGTCCAAGCTGCCCAACATCATCTCAAGTATAGGGAATGACAAGCCGGTGATTGATGTCCTAGGCGTTGGAAGTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAGGGAGCGTGTGGCAAAAGCCCCTTATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCTTGTCAATGAAGATAATCAGATGAGAAAGTTTGATTTCATTCACATGATACATATGTTATATAATGTAAAGGATGTCTTGTGTAACTTAATATTCTTTAAATGCTGCTTGGCACCCATTGTGAAGCTACTGATCATTCTTGTATCGGGTAATAGTGGGTGGGCCACTCTATGGTATAAATATGGTCATCGGCTGCCTTCTGTACATCTCTGCCTTTAAATTATGTTTGAAATTATCTTTAGATGCTATTTCAATTGGCTCCGTGTTCATAGCCCTAACTGTTTCTTTTATAGACTCATAGTATGTCTATCTTAGGGATGATCTGGGTACTTCTGTTTACTTCTAGTTTAACTTTTATTTATTATAG
  5   1   2       bld FaBN                            IMAGE:8077598.5p                                                                                                                                                                                                                                                                                                                                                                                GTGGATCAGGTGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGGGTCCCCATTAACAACCAGATTGTGGAACCAAGCGCTGAGCAAATCTTTGGCTACAGGGAGCGTGTGGCAAAAGCCCCAAATCTGGAAAATGTCACCTTCTCCTGGCATCGCCAGACCTCCAGTGAATTTGAGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAAACAAGCCCCTTTGCACACAGGCTGGGGTTGTCATCTTTGAGTTACTTTAGTATGATGAGAGCTGATATCTGAAAACTCACAATGGTTTTATTTTTATACTGTGGATTGAATATTACTCTTATCACTGCCTCAGTTGCATTTAA
  3   1   2       add FaBN 5g3  in                    IMAGE:8074424.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCACACTCCAGGATTTGGAGCCAGTCACGAAGATAGCAGATGAGAAAGTTGATTCATTCACATGATACAGATGTTTATTATGTAAGGATGTCTGGGAACATTAAATTCTTTAAAAGCTGCTTGGCACCCAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACATTACGGCAGGAGATATCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAATACAAGCCCCTTTGCACACCAGGCTGGGGTTGTTCATCTTTGAGTTAACTTTTAGTATGATGTAGAGCGTGATATTCTGAAAAACTTCACAATTGGTTTTTATTTTTTATTACTTGTGGTATTTGAATTATTTAGCTCTTTATTCAACTGCTCTCCAGTTTGCAATTTTAGCAATTTAGTCTAAATTACCCATGCACTGATTTGCATAAGAGACTGGAATATAAATAGGAGAGGGCCCAACNG
  3   1   2       bld Te2  5g3  in                    IMAGE:7207099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGCCAAGTCAATGAAGATAAGCAGATGAGAAAGTTTGATTTCATTCACATGATACAGATGTTATATTATGTAAAGGATGTCTTGGGAACATTATAATTCTCTAAAAGCTGCTTGGCACACAGTGGGAAGCTACTGATCATTCTTGTATCGGGTAACAGTGGGTGGGCCACTCTATGGAAGAAATATGGCCAACGGCTGCCTCTGAACGACCTCTGCCTGTACACTACGGCAGGAGATATCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAATACAAGCCCCTTTGCACACCAGGCTGGGGTTGTTCATCTTTGAGTTAACTTTTAGTATGATGTAGAGCGTGATATTCTGAAAAACTTCACAATTGGTTTTTATTTTTTATTACTTGTGGTATTTGAATTATTTAGCTCTTTATTCAACTGCTCTCCAGTTTGCAATTTTAGCAATTTAGTCTAAATTACCCATGCACTGATTTGCATAAGAGACAGGAATATAAATAGGAGAGGGCCCACACAGCAGAGACGAGTAAATCAAAAACCC
  3   1   2       add Ov1  5g3  in                    IMAGE:8328459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTACTGATCATTCTGTATCGGGTAACAGTGGGGGGGCCACTTTATGGAAGAAATATGGCCAAACGGCTGCCTTTGAACGACTTCTGCCTGTACATTACGGCAGGAGATTTCGCAGAGATGCTAAGTTCAATGGGCGCCCGGTTTCAGAGCCACGAACTGCAGTCGTATATGGACATCACGGAATGTTTCATCGAGGGGGACAGAGATGGGGAACTTCTGTTGGACTTTCTGACTGAGACGTGTGACTTTAAGAGAAATGCCCCTGCTGATCTCAGGGATCAGATTATCTGTGACCTAAAAAGCCCTGGCTGTAGTACAACAAAAGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTGGTGGAGGCAGATTAGTTAGTCTAGGGAATACAAGCCCCTTTGCACACCAGGCTGGGGTTGTTCATCTTTGAGTTAACTTTTAGTATGATGTAGAGCGTGATATTCTGAAAAACTTCACAATTGGTTTTTATTTTTTATTACTTGTGGTATTTGAATTATTTAGCTCTTTATTCAACTGCTCTCCAGTTTGCAATTTTAGCAATTTAGTCTAAATTACCCATGCACTGATTTGCATAAGAGACTGGAATATAAATAGGAGAGGGCCCAAACAGAAAGATGAGTAATAAAAAGTAGCAATAACAAAAAAAAAAAAAAAG
  3   1   1       add Tad1      in                    IMAGE:6878079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCTTTTGTTTTGTAAGGTTATTGCCGGGGAGACATGGCAAGAGATGCTTAGTTTCAATGGGCCGCCCGGTTCCCAGAGTCACGAACTGCAGTCGGAACATGGACATCACAAAATGTTTCATGGAGGGGGACACAAAGGGGGAACTTCTGCTGGACTTTCTGACCGAGACGTGTGATTTTAGGAAAAATGCTCCTGCTGAGCTCAGGGATCAGATTATCTGTGACCTAAAAAGTCCCAGGTGCAGTACAACAAAGGATGGGAAGGTTATTTTTAACAACAACCTTAGTGTGATTGTAGTGGAGGCGGATTAGTTGGTCTGGAGTGGAGAACACAACCCCCTTTCCACACCAAGCTGGGGGATCTTTAATTTACATAGATTGACTGCTGTAAACCATAGCAAACAGTCAACAGTTATTTCCAATGAGTCAACAGCAGTGATTGACAGTTCCACCCTAAAAACTCAAAAATATCTCTATTATCATGCTATTGAGAAAAAATGATTTATTATATCATATTAAAATACAATAATAACCCCACACGTAGCCCAAAATGTTTCATGCTTCCCCAGCACTTAATCATAGGCAATCTCAAATAGGACACATGTTTCTATATATACATTTTCAGTTATCTGTTATGTATAAGTTCCAACCTGGTTGGACTAATATTTGGGTACAATACCTACTAGATACTGTTGGAAACCCAGATTGAAGGTCAAGTTAAAGTGAGAGCTAGGATAAACATTGTTTATCTCTACCATATATTCATAGAACTATGGTTGAATGGCTGATACAGGAATTTTATGGTTTAATGGCTGATTCAGGAATTTTTTAAATGCACTATTTGGGGACGGGTTCTGATTAAATTTTGGTGGTTTTGTGACCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)