Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk70g07ex.3                         43 END     3          27        6                (no blast hit)
     2   2.0    0Xl3.1-XL047f20.3                           22 END     4          36       18                receptor tyrosine kinase [Xenopus laevis]
     3   2.0    0Xl3.1-xlk64e11ex.3                         12 END     2          18       16                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012775266 Xl3.1-XL495k08ex.5 - 11 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                     2     5     5     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     8    10    10    10    10    10    11    11    11    11    11    11    10    11    10    11    11    11    10    11    11    11    11    11    10    11    10    11     9    11     9    11     8    10     7     9     6     9     5     9     7     9     6     6     2     4     3     4
                                               BLH ATG      60     424                                                                
                                               BLH MIN      30     122                                                                
                                                                                                                                                                                               PROTEIN --- Ce ---- 2e-016     NP_494807.1 ephrin receptor type-A, Variable ABnormal morphology VAB-1 (124.7 kD) (vab-1)[Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Dm ---- 3e-029     NP_726591.2 CG1511-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Sp ---- 4e-032     XP_001199672.1 PREDICTED: similar to Ephrin type-B receptor 2 precursor (Tyrosine-protein kinase receptor CEK5), partial [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Ci ---= 1e-051     NP_001121577.1 ephrin receptor epsilon [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - Xt ---- 3e-078     NP_001090817.1 hypothetical protein LOC100037915 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 4e-111     XP_536084.2 PREDICTED: similar to Ephrin type-A receptor 4 precursor (Tyrosine-protein kinase receptor SEK) (Receptor protein-tyrosine kinase HEK8) [Canis familiaris] ------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Dr ==== 9e-112     NP_001005919.1 epha4a [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Hs ==== 8e-123     NP_004429.1 EphA4; Hek8; TYRO1 protein tyrosine kinase; ephrin receptor EphA4 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Gg ==== 7e-123     NP_990112.1 Cek8 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Bt ==== 5e-123     NP_001076910.1 ephrin receptor EphA4 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Mm ==== 5e-123     NP_031962.2 Eph receptor A4; rabbit [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Xl ==== 2e-134     NP_001090183.1 receptor tyrosin kinase [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL495k08ex.5                                                                                           TAA------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG
  5   1   2       bld Ga12      out                        XL220e15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGNTCCNTGACACCATTACAGGTTCAGACACCTCTTCTTTGGCGGA

In case of problems mail me! (