Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8070934.3                       7 END     6          54       85                serine (or cysteine) proteinase inhibitor, clade E, member 1 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8642646.5                       6 PI      91         57      779                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012775279 Xl3.1-IMAGE:8074431.5 - 11 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8074431.5                GGAAACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTCCCGGAGAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGATTGTGCAAATGATGGCCAACACTGGGAAATACAACTACGGTGAGTTCACA
                                                  Xl3.1-CHK-1012694857                      AGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTCCCGGAGAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGATTGTGCAAATGATGGCCAACACTGGGAAATACAACTACGGTGAGTTCACAACCCCA
                                                      consensus depths                     5     6     7     8     8     8     8     8     8     9     8    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    10    10    10    10     9    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     8    10     7    10     7    10     7    10     7    10     7    10     5     9     3     9     4     9     4     8     4     8     3     6     3     5     2     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                    --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                               BLH ATG      66     197                
                                               BLH MPR       0      67                
                                               BLH OVR      66    1204                
                                               ORF LNG      66      46                
  5   1   2       bld FaB  5g                         IMAGE:8072442.5p TCGGTCCGGATTCCCGGGATCAGCTGCAGAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCTTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCATGGTTCCTTCAAAAATTTCAAGCAACTTTCCTCCGACATGTTAGCCAAATCATTTTTACTGATGCAACCCAAGCCAATGACATCATTAATTAATGGGTAGAGAAAAAAACTGATGGTATGATCAATATTTATTGGGGAGCACAACATATCTCATCTGACCCACATGGCTATTAATGCCAACCTTCAAGGAAATGGATGCTCCTTCCGGAAAAGCACACCCACTCCATCTAATACTATGGGCTATTTATGTCAATGAGGCAACATGGAATCATACTG
  5   1   2       bld Spl  5g                         IMAGE:8462947.5p    AAAGCTTGAAGGGGAAACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTCGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCTGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAACAAAAATCTCCTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAACTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTGGTGCTATTAAGTGCTGTACACTTCAGTGGCAATGGACTGTCCATTCCCGGAGAAGCACACACAGCGCCCATCTACAATCTGATGGTCTCCGTCATGTGCAATGATGGCACACTGGAATACACTACGTGAGTCACACCCAGTGGGATTTTAGAGGATAACTGCTATGAAGAAGACTCACTATATGCGCTCTAGAAGGG
  5   1   2       bld FaB  5g3  out                   IMAGE:8071235.5p     AAGCTTGAAGGGGAAACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGTGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAGCAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCACAACATACCTCCACTGACCGTCTTGTGCTATTAGTGCTAACCTTCAGTGGCAATGGATGTCCATTCCNGAGAAGCACACACAGCGCCATCTACAATTATGGTCCACTGATGTCAATGATGCACCTGG
  5   1   2       bld FaBN 5g3  out                   IMAGE:8074431.5p     AAGCTTGAAGGGGAAACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAGCAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTNCCGGAGAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGATTGTGCNAATGATGGCCAACACTGGGAAATACNACTACGGTGAGTTCACACCCCAA
  5   1   2       bld FaBN 5g3  out                   IMAGE:8075409.5p     AAGCTTGAAGGGGAAACAGCTGCAGAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCTTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAAATTTCAAGCAACTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTCCCGGGAGAAGGGCAACACACCAGCGCCCATT
  5   1   2      seed FaB  5g3  out                   IMAGE:8070934.5p               GGGGAACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAGCAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTCCCGGAGAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGATTGTGCAAATGATGGCCAACACTG
  5   1   2       bld FaBN 5g                         IMAGE:8078979.5p                    ACAGCTGCACAGAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGCGGGTACAGATCTCCAGACAGCAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGTCCCATTCCCNGAAGAAGGCACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGAA
  5   1   2       bld Tbd7 5g3  out                        XL074b06.5p                      GCTGCACAGNAACAAGCCTCGCTGTCTGAGTTTGGTTTGTCATCCAGAACATCAGACAAAATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTGGTGCTATTAAGTGCTATACACTTCAGTGGCAAATGGACTGT
  5   1   2       bld Tad1      out                   IMAGE:6877410.5p                                                      TGACTCTCTCGTACTTTCTCCTGAACTTCTTATTTCTCTCCGCAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAGATTTCAAGCAATTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCCAAGCCAAGGACATCATTAATCAATGGGTACAGAAAAAACGATGGATGACAATTAGGAACCACCTGCGTGGTGTATGGTCAAGTCnnnnnnnnnnnnnnnnccnnnncnnnnnnnnnnnnncnnncnnnnnncnncncncgcccccnncccncccnnccccccccccccccccccccccccccccccccccccccccccccccccccccccccnccnnnnccccnccccccnccccccnncnccncccccccccnccccccnncnccccccngnccccccccccgcccccccccccccccncccccgcggnncaaccccnccccnncnncccccncccctcccacgccccccgccncccgcggncgccgcgccggccncgnccgctgctcgcgcgccTGCGCCNNCAGGCTCCGCGCNCNNNTNGNNCCATCCNGCNGTAN
  5   1   2       bld Tbd7                                 XL067b06.5p                                                                           CAGACAAAATGTCTACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCCTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTGGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGG
  5   1   2       bld Bone                            IMAGE:8743441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAAATTTCAAGCAACTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTGGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTCCCATTCCCGGAGAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTGATTGTGCAAATGATGGCCAACACTGGGAAATACAACTACGGTGAGTTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAGAGGAGCTCAGCATGATTATTGCTGCTCCTTATGAAAAAGGTGTTCCCTTATCCACCATCACCAACATCCTGACATCTGAGCTCATTGTCCAATGGAAAGCCCAAATGAAGAAAGTAGCACGACTTCTAGTCCTACCCAAGTTCTCTCTGCTTAGTGAAGTAGATCTGAAGAAGCCTCTAGAACGTCTGGGGATTACTAACATGTTCACTGAAGAGACAGCAGACTTCAGCCGCTTGTCCTCTGAAAACACTATATGTTTCTGAAGCTTTTTCAAAATCAAGGTGTAGTGACAGAAGGTACGAGAGCATCTGCAGCACCAGCTGCTATCTGCTAGCTCGGATGCTCCCTCTGAAGTATCATGGACCATCTTCTGGTCCATGGTCCGACACACAGTAACTGCTATTCTGGACG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)