Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8542960.5                       7 END     1           5       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL411l06ex.3                         10 PI      89       1104     1306                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775952 Xl3.1-IMAGE:6866778.5 - 17 ESTs
                                                                       ....-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6866778.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTCTGTCCATCCAAAAGGCACAGACCCCAAGAATACCAATATATTAAAAACCTGCCTACTGAACCTGCTGACCGGAAGAAACTGGAAGATGAAGAAAAGGAAGAAGAAGTAAACGACTTTGAAAATGGCAAGCTTGAAGACAAAGAAGCAAGTGATGTCCCTCAGGACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGTTTATGGGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTAGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAA
                                                  Xl3.1-CHK-1012690901                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGATTTTGGTGTTTGTGGCAGACTTCCTCTGTCCATCCAAAAGGCACAGACCCCAAGAATACCAATATATTAAAAACCTGCCTACTGAACCTGCTGACCGGAAGAAACTGGAAGATGAAGAAAAGGAAGAAGAAGTAAACGACTTTGAAAATGGCAAGCTTGAAGACAAAGAAGCAAGTGATGTCCCTCAGGACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGTTTATGGGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTAGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAATTTTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     7     6     7     6     8     6     8     6     8     5     7     5     7     5     7     5     8     6     8     6     9     5     9     5     9     5     9     5     9     5     9     5     9     6    10     6    10     7    10     7    10     7     9     7     9     7     9     8     9     8     9     9    10     9    10     9    10     7     8     7     7     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     8     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9    10    10    10    10    10    10    10     8    10     8    10     8    10     8    10     8    10     8     9     8     8     8     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     3     6     3     6     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 2e-007     NP_082615.1 thioredoxin domain containing 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 3e-008     XP_853432.1 PREDICTED: similar to Thioredoxin domain containing protein 1 precursor (Transmembrane Trx-related protein) (Thioredoxin-related transmembrane protein) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bt ---- 1e-009     NP_001068853.1 thioredoxin domain containing 1 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 6e-010     NP_110382.3 thioredoxin domain containing 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 4e-029     CAJ81944.1 novel protein containing thioredoxin domain [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Xl ---- 4e-038     NP_001121246.1 hypothetical protein LOC100158326 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6866778.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA------------------------------------------------------------------------------TGA------------------------------------------------------------ATG---------------------------------------------------ATG------------TAATAA------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------TAATAA---ATG---------------------------------------------------TGA------------------------------------------------ATG---------------------------------------TAA---TAA------------------------------------------------------------TGATAG------------------ATG---------TAATAA------------------------------------------------ATG---------------------------------------TAA---------------------------------------TAA---------------------------------------------------------TGA------------------TGA------------TAATGA---------------------TAG------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                              ]
  5   1   2       bld Emb4                            IMAGE:5571174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGGGACCGGAAGAGGTGAAGAGAGTTGCAGAATTTGCTGCCCATTCTTGGTCCTGGCACGCGTGGAGCTGGCGAGATGAAGAATTATTTTTTCTGAGACAGCTGCTTTCAAGCTTGGAACATCCATTGGGACAGTATTTATGCTGATATTATCTGCGCAACCGCTGCTGGAACAGAAAAAAAGGTCTATTTTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTCTGTCCATCCAAAAGGCACAGACCCCAAGAATACCAATATATTAAAAACCTGCCTACTGAACCTGCTGACcggaagaaactggaagatgaagaaaaggaagaagaagTAAACGACTTTGAAAATGGCAAGCTTGAAGACAAAGAAGCAAGTGATGTCCCTCAGGACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGTTTATGGGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTANGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAGCATAAANTAAAGGGTTGGGGTTAAAAATCAAATTTGTGGCCAAAAAAAGAATTTTCCCAGGCAATGGAAAACTGCAATAATTAAGGAATGGAATAAATGTACCGTAAGGTGaaaaaaaaCCATGGG
  5   1   2       bld Tad2                            IMAGE:6936548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGACCCTATTTCTAGGTCTATTTTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTCTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATATATTAAAAACCTGCCTACTCTACCTGCTGACcggaagaaactggaagatgaagaaaaggaagaagaagTAAACGACTTTGAAAATGGCAAGCTTGAAGACAAAGAAGCAAGTGATGTCCCTCAGGACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGTTTATGCGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGGTTATTTGTAATTACCAATACCTGTTACCACCTTAGGGGGCATCCCAGAAGGCATTATAAGGTACTAATGGCTTTTAAAGCCCTCAaattttggtttgggggttaaaaattcaaatttgtttggcccaaaaaaagaattttttCCCCAGGCCTATTGAAAAAACTTCGCCGAAAATCCACTGTCTTGGAAATTAGGTGGTACCCACTTATGGTTGAAAACAGAGGTCCCATTTGGCAAGTTTTCAGGTGGGCgccttttttaccttgccaccttttgccctttttttttACTCCGCCTTA
  5   1   2       bld Emb4                   IMAGE:5571174-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAATATATTAAAAACCTGCCTACTGAACCTGCTGACCGGAAGAACCTGGAAGATGAAGAAAAAGATCAAGAACTAAACGACTTTGAAAATGGCAAGCTTGAAGACAAAGAAGCAAGTGATGTCCCTCAGGACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGATTATGGGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACCCACAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGGTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGCGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATAC
  5   1   2       bld Egg2      in                    IMAGE:5162445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCAAGTCATCTTGTGAGAAGCTTAGGATTTCGCAGTCAGCTGTGCTGCACATTACAATTGTCTGAGGTACAAATGTTATACTTTTGTCACTTTTCGTTACTAGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTAGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAG
  5   1   2       bld Egg1                            IMAGE:4678916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTAGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCATAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAG
  5   1   2       bld Egg1                               PBX0165E03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAACTCCCTACAGTAATTTAGGTATGATATCCTTCTCATTGTGGTGCATTAATGCAATCTTCCCCTGTTTTCCTTGCATGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTAGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAACTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAG
  5   1   2       bld Egg1                               PBX0068H06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACGAGGGAAATCACTGATTTAATAAAGGAAATGGGCTTTGCAAAGATTACTGTTACTAACGTATTTTCCATACAGTTATTGTAATTACAATACCTGTAACACCTTATGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTG
  5  -1   2       bld Egg3                            IMAGE:6866778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTTAACGGTATTTTTCCCATACCAGGTTATTTGTAAATAACCATTACCTGGTAACAACCTAGGGGGGCATCNAAGATGCATTTATAAGTACTAATGCTTTAAAAGCATAAATATGTTTGGGTTTAAAATCAAATTGTTGGCCAAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAATTTTTAGATACACaaaaaaaaaaaCCCGGGAATC
  3   1   2      seed Egg2      in                    IMAGE:5162445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGGCATCAAGATGCATTATAAGTACTAATGCTTTAAAGCATAAATATGGTTTGGGTTAAAATCAAATTGTTGGCCAAAAAAGAATTTTCCCAGGCAATGAAAAACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTAACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATT
  5   1   2       bld Egg1                               PBX0153D07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCTAAGGAAACGTACTGCCAAGTCTTGATGTTTATGGGGTTTCTTCTTTTATGGTCAGAACAGATGTCACAGATCCTTGCACTCCATACACAGAAACAATTCATTATGACCGCTTTCAAGAATTCTGCCTGTTCTCCAATTTATTCCAACTCCCTACAGTAATTTAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAATTTTTAGA
  3   1   2       bld Ga12                                 XL143c03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGCAATAATAATGTATGAATAGATGTACAGTAGGTGAAGAGAGCCAATGGAGTTTAGGGGGCTTTACTTGAGTTGCTTTTTACAGCTTTACAGAACAGAGGGAACAGCAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGCTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTANCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTCTGTANA
  3   1   2       bld Egg6                            IMAGE:4435377.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGCTGCATCATGACTACCTGCAAACTGCTGAAATGTGATGTCAGAGTAGTTTAATTATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATGAATAA
  3   1   2       bld Ov1       out                   IMAGE:5049029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATAAGACTACCAGGTGTTGGACAGTTGTTACAGGGTATGCACAGACGTTCTTTTACTTTATTATTGATAGCACTGTAGACCATTAACAATGCAAAATAGTTAATAATTCTTGTCGTCTTTTTGTTTTTACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAATTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATGAAACTGTTTTTGCTTTA
  5  -1   2       bld Ga18      in                       xlk65l12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCtttttttttttACCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACNCTTTTTNNAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAATTTCAGGAAACNCTTTTTNNAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAATTTTNNNNNACACAAGTGaaaaaaaag
  3   1   2       bld Ga18      in                       xlk65l12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTTTTTTTTTTNCCTTCTGAAGAGCCAAATAACGCATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGTTTTCATTTAGATTCTGGTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTNCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAATTTCAGGAAACACTTTNNNNNAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTNNTTTCTTGG
  5   1   2       bld Gas5      in                    IMAGE:3750563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAATTCCTTTTGGGGAAAATTTGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTG
  3   1   2       bld Gas5      in                    IMAGE:3750563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATGGGATCCAGTGTTGAATTTGCGTTGTATAATGATACCATATAACAGCTTTCATTTAGATTCTGGTTTTGGGGAAAATTAGTATAAGTTCAGGAAACACTTTTTGCAAAGCTAAACTGCACAGTCTTTGTAAATCAGTTTGCTTGAAAATATATGTTGTATTTTTGTAACATGCTGCAATGAATAAACTGTTTTTGCTTTCTTGGTGAATTAAATTTTAGATACACAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)