Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6864338.5                       7 END     1           9       14                hypothetical protein LOC495078 [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:5541913.5                       5 END     1           9       20                eomesodermin [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk147g13ex.3                         6 PI      90          1      762                eomesodermin [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012776397 Xl3.1-xlk164i12ex.3 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk164i12ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGGGTGTATACAAGTGCTTGCAAGAGAAGGAGACTCTCCCCTAGCACCTCAAGCAATGAAANCTCCCCTCCTATAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGAGCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTGTTATTTTTAATAAATGTGGTGCCTCTTGGGA
                                                  Xl3.1-CHK-1012695130                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTATACAAGTGCTTGCAAGAGAAGGAGACTCTCCCCTAGCACCTCAAGCAATGAAAACTCCCCTCCTATAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGAGCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTGTTATTTTTAATAAATGTGGTGCCTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     1     3     3     3     3     3     3     4     5     6     6     7     5     6     5     6     5     6     5     6     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7     8     6     8     6     8     6     8     4     8     6     8     7     8     7     8     7     8     6     8     9    10     8    10     8    10     7    10     7    10     8    10     8    10     8    10     8    10     7     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     5     7     6     7     5     7     2     2     2     2     2     2
                                                                       ...PROTEIN --- Dr ---- 1e-010     NP_571754.3 eomesodermin homolog [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-014     NP_005433.2 eomesodermin; t box, brain, 2 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-014     NP_034266.2 eomesodermin homolog [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 5e-015     XP_850738.1 PREDICTED: similar to eomesodermin isoform 2 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 2e-015     XP_001251930.1 PREDICTED: similar to eomesodermin [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-017     XP_426003.2 PREDICTED: similar to eomesodermin [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 8e-022     NP_001122124.1 eomesodermin [Xenopus (Silurana) tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 1e-023     NP_001088247.1 hypothetical protein LOC495078 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                   Xl3.1-xlk164i12ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAA------------------TAATAA---------------------------ATG---------------------------------------------------------------------------------------ATGTAATAA---------------------------------------ATG------------------TAG---------------------------TAA------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG---------------------------------------------------------------------------------TGAATG------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                     ]
  5   1   2      skin Gas6                            IMAGE:3473825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGCAACCTTTCTTCCAGGAACCAGTTTGTCAACAANCCTGCCCCCTGCCAGATACTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGCCTCCTGTCCCCACAGACTAATGAAGAAGTGGTAAATGCTCCCCCACAGAGGTGGNTTTGTTACCCCAGTCCAACAAGCTGCTACAAATAAACTGGACATGGGGTCCTATGAAACAGACTACTCCTCAGGTTCTTTCCTCACCTATGGTATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCTGCCTTTGCCTCCATGGCAAGCTGGGGAAGCAGAGGTTCTACCTATCAAAGGAAAATGACAACAAGTATACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCCTGTGTAGAAACCCCTCCCTCCATTAAATCACTAGACTCTAATGATTCAGGGGTGTATACAAGTGCTTGCAAGAGAAGGAGACTCTCCCCTAGCACCTCAAGCAATGAAAACTCCCCTCCTATAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACA
  3   1   2       bld Ga18 5g3  out                     xlk164i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANNGATGAGCNNNTCCTNGGTAGAANCCCNCCNNCATNAAATCNCTAGNCTCTAATGATTCAGGGGTGTATACAAGTGCTTGCAAGAGAAGGAGACTCTCCCCTANNACCTCAAGCAATGAAANCTCCCCTCCTATAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGANCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTNCCTTGCTTTCTCTTTCCTTTTTGTTATGTNCATATTG
  3   1   2       bld Ga18      out                     xlk165b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCNGGGTAGAANCCCTNCCTCNATTAAATCNCTAGNCTCTAATGATTCAGGGGNNNATACAAGTGCTTGCANNGNAGNAGACTCTCCCCTANCNCCTCAAGNAATGAAANCTCCCCTCCTATAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGANNAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTNCCTTGCTTTCTCTTTCCTTTTTGTTATGTACATANGCTGT
  5  -1   2       bld Bla2                            IMAGE:7298185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTCCTATAAAAGTGTGAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTAtttttttgttttCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGAGCAAAGCAGGTTTTATGAatatatatatatgtatatagttgtttttatatatatttataaatgtataaatatatataattattattatgttttatttatGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTGTTATTTTTAATAAATGTGGTGCCTCTTGGGAAATCTaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCCATGATGCGGGG
  3   1   2      seed Ga18      in                      xlk141p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNGGACGCGTGGGTTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGANCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTNTTATTT
  3   1   2       bld Ga12                                 XL148l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGACATTGGCACTGAGGACTATAAAGATGGCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAAGAGCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATACAGTATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCACTGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACNAATGTAAA
  5   1   2       add Ga18      in                      xlk141p15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNNNNNCACTGAGGACTATAAAGATGGNACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGNCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGNGGGNTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGNGTTAAAGCCTCTGTATTAtttttttgttttCAAAAAATGTAATANGCTGTAATAAGCTTGGNCTAAAGAGCAANNNNGNTTtatgaatatatatatatgtatatanttgtttttatatatatttatnaangtataaatatatataattattattatgttttatttatGGCACAAAANGNCNATGTACATTTATTGTATATACACCTGCATATTGTGGAGNATAAGATATTGTATAAATAGCAGCG
  3   1   2       bld Ga12                                 XL186n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAAGAAAGGTTCATTTGCTGTAATAATATAACCCTGGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCACTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGNTTGGCANTAAAGAGCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATTTATAAATGTATAAATATATACAGTATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCACTGTACATTTATTGTATATACACNTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGACAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTGTTA
  3   1   2       bld Ga12                                 XL175p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTCTTAAAGAAAGGTTCATTTGCTGTAATAATATAACCTTGGGGATGGACTATTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTCGGCATCCTCANTCAGCCATGAAAGTGTTAAAGCCTCTGTATTATTTTTTTGTTTTCAAAAAATGTAATAAGCTGTAATAAGCTTGGCACTAAANANCAAAGCAGGTTTTATGAATATATATATATGTATATAGTTGTTTTTATATATATnTATAAATGTATAAATATATACAGTATGATTATTATTATGTTTTATTTATGGCNCAAAAAGCCACTGTACATTTATTGTATATACACCTGCATATTGTGNAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAA
  3   1   2       bld Ga18      in                        xlk4l01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTNCTTTCTCTTTCCTTTTTGTTATGTACATANGC
  5   1   2       bld Ga18      in                        xlk4l01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAATGtataaatatatataattattattatgttttatttatGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGCTGTACCTGACATAAAATGCACTGGTGGGCTGTATATTGTATAAGTGGCACAAAGCTGTATATTTGTAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAGGGCAAATCTTGTACAAATGTAAAGTCCAATATTGAATGTTCCAGAATGGGAATGCATTGTGCATTTACCTTGCTTTCTCTTTCCTTTTTGTTATGTACATATTGCTGTTATTTTTAATAAATGTGGTGCCTCTTGGGAAATCTaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)