Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6950227.3                       4 PI      91         36      781                MGC84117 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 92%

 1012776886 Xl3.1-IMAGE:6949761.5 - 7 ESTs
                                                                       ...-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6949761.5                                                                                              AGGCATTTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACTGTGTGTGTGTGTTTGTGAGACCTCAATCTTTTTTTCCATTCCAGAATAAAGTCATACAATAGATGTGTTGATGACAGAGCA
                                                  Xl3.1-CHK-1012699733                                                                                                    TTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACTGTGTGTGTGTGTTTGTGAGACCTCAATCTTTTTTTCCATTCCAGAATAAAGTCATACAATAGATGTGTTGATGACAGAGCAAAGGTT
                                                      consensus depths                                                                                                   4     5     5     5     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     5     2     5     2     5     2     5     2     5
                                               BLH ATG      72     654                                                                                              
                                               BLH MIN      72      96                                                                                              
                                               BLH OVR      72      90                                                                                              
                                               CDS MIN      72      35                                                                                              
                                               EST CLI     -12      35                                                                                              
                                               ORF LNG      72       2                                                                                              
                                                                       PROTEIN --- Ci ---- 4e-024     NP_001027949.1 potassium channel-interacting protein KChIP [Ciona intestinalis] ---------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 7e-040     NP_492651.1 neuronal Calcium Sensor (22.0 kD) (ncs-2) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED = Sp ==== 4e-049     XP_001177012.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN -== Dm ==== 1e-050     NP_788543.1 Neurocalcin CG7641-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN -== Ag ==== 2e-051     XP_308553.4 AGAP007247-PB [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Mm ==== 2e-075     NP_033064.1 recoverin; guanylate cyclase activator; cancer associated retinopathy protein[Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Bt ==== 1e-076     NP_776590.1 recoverin [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Cf ==== 1e-076     NP_001014303.1 recoverin [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 7e-077     NP_002894.1 recoverin [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Dr ==== 2e-079     NP_001025419.1 hypothetical protein LOC570333 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Gg ==== 1e-084     NP_990845.1 calcium binding protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 2e-102     NP_001008164.1 MGC79749 protein [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 3e-110     NP_001086398.1 MGC84424 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6949761.5                                                                                                             TGA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATGATG------------ATG---------------------------TAA---------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Brn1 5x3                        IMAGE:6949761.5p                                                      CTGGTACCGGGTCCNGGAATTCCTCGGGCATGCTTGAAAGGCATNNTTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACtgtgtgtgtgtgtttgtgAGACCTCAATCTTTTTTTCCATTCCAGAATAAAGTCATACAATAGATGTGTTGATGACAGAGCAAAGGTTTTTAAAGGCTATCGAAGCATCATTTCAGTTATTTACATTTTCTTCTTGAATTATAATATTCGCCAAATAACAGAATTGAGAAAGTCATGC
  5   1   2       bld Brn1 5g                         IMAGE:6954145.5p                                                                                  GGCAGGCTTGAAAGGCATTTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAAAAGAGCAGAAGAACCTGCCCGGAATGATGAAAATACCCCCACCAAAAGAAGAGCACGACCAGCCTATGGGGCCCTACTCCCAAAAAAGAAATGATGGATGCTTCAAAATAGCCGGAGGGGAAGAAATTCCATTTCAAATGGCGCTCTATTGATTGGAAACGGAACTAAAGATTCCTTGGGAGCTTCCTTTATATTCAAATCTAccccccccccGCAAAGTAAAAAATTAAGGCCGGCGCCCAACTTGGGAAGGGGCGGATAATGAAACGAATGGGCGGGGAAAAACCGCCGCAAAGCCCGCAAATTTGCCCATCTTCAACAGCAAATCCGGGGAACCGGCTGTCCGGTGAGTGGTTGGTCCTCGGTTGCAAAAAACCTCCACAAACTCCTTTATTTTTTTGCCCCGGTTCTCCTGGAACATTAATACGCACCCCTTTCCAACTCATACGAACTCAGGCCTTGAAATAGAAACCGGAAACCCTAAAAGATGTGTTTTTCTTCACGCGGCTTTCTTCAACAAAACCGCCACCCATGTTCGCGAGTTTAGATTCTTAGCA
  5   1   2       bld Brn1 5x3                        IMAGE:7019444.5p                                                                                   GCAGGCTTGAAAGGCATTTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGTGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGATGATGATGCTAAAATAGCCGAAGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCCATACACCCCGAAAAAATTAACGGCCACCTGGAAGGGAAAGAAAAATTGGGAAACCCCCAGCCGAATGGCCAAATAAAAATCGGGACTgggggggggtggggggtttggggaaaccctccaatccttttttttcccttcccagaaaaaaagttcctttccaaaaaaaaGTTGTTGGATAAACACGAGCCCAAAGGGTCTTAAAAAGGGCTTTTTCTGAAAACCATACCCTTTCCAAgtttatttttacaacatttttctcttccttttgaaaaaaagcaatttttaaaTCTA
  5   1   2       bld Brn1 5x3               IMAGE:4740010-IMAGp.IMAGp                                                                                    CAGGCTTGAAAGGCATTTTGTCTGGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACtgtgtgtgtgtgtgtTTGT
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956846.5p                                                                                        CTTGAAAGGCATTTTGTCTGTTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACtgtgtgtgtgtgtttgtgagacctcaatcttttttttCCATTTCCAGAATAAAGTCATACAATAAGATGTGTTTGATGACCAGAGCAAAGGGTTTTTAAAGGCCTATCCGAAAGCATTCATTTTTCAGTTAATTTTACCATTTTTT
  5   1   2      seed Brn1 5x3  out                   IMAGE:4740010.5p                                                                                                           GGTGAAATCTACAAGACACAGATTCCAGGGCTGCAGGGTTTGGAGCAGCGGGGGTGACTATGGGGAACGCCAAGAGTGGGGCTCTTTCTAAAGAGGTCCTGGAAGATCTTAAAACAAACACAAGGTATTCAGATGACGAACTCTGCAGATGGTATGAGAGTTTCAACAAGCAGTGCCCCGATGGCAAAATAACTCGCACGGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCCATTCTGATCCTAAGAGCTACGCCAGGCATGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAG
  3   1   2       add Brn1 5g3  in                    IMAGE:6956846.3p                                                                                                                                                  TTCTTTTTTTAAAAAGAGGGTTCCCCTGGGGAAGATTTTTTTTAAAAACCAAACCCCCAAGGGTTTTTTCAGGATGGGCGAAACTTTTGGCAGATTGGTTATGAGGAGTTTTCAACCAAGCGAGTTCCCCCGATGGCCAAAATTAATTTGCCCCGGGATTTTTGGGAAGATTTATGCCAATTTTTCTCCCCCCCTTTCTGATCCTAAGAGGTTAGGCCAGGCATGTGTTCCGTAGTTTCGACACCAATGAAGATGGTACATTGGACTTTCGGGAGTACATCATTGCCCTGCATCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTTGACAAAAATGGAGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCTATATTCAAGATGATCCCACCAGAAGAGCAGAAGAACCTGCCGGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGAATGATGATGCTAAAATAGCCGAGGGAGAATTCATTCAAGGCGTTATGATGAACGACGAGATCATGAGTCTTATTCAATACACCCCGAAGAAATAAGCGGCCACTGAAGGGAGAGAAGATGGGGAAGCCCAAGCGAATGCCAATAAAGATCGGACTGTGTGTGTGTGTTTGTGAGACCTCAATCTTTTTTTCCATTCCAGAATAAAGTCATACAATAGATGTGTTGATGACAGAGCAAAGGTTTTAAAGGCTATCGAAGCATCATTTCAGTTATTTACATTTTCTTCTTGAATAATAATATTCGCAAAATAACAGAATTGAGAAAGTCATGCAGCTTATCCCAGTTCACTGCAATTAAAAAGTAGTGAATCTTTGGTTCGCGACATTCCTCATGAAATCCAGTCTTGAGGAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)