Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL038c13.3                            9 END     3          25       33                Unknown (protein for MGC:181855) [Xenopus laevis]
     21.3999999999999999    0Xl3.1-xl233p24.3                            7 END     5          41       71                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012777288 Xl3.1-xl232d19.5 - 12 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl232d19.5   GCTGACAGTGCGAGGACTGGGCTGGGACTGACACACACACACACACACTTACACACACAACAGAGAGAGAGAGGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGAGCCCAAAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAAGATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTCCCCATCCACCCAGTTCAACAGTGGGCAGCTCTGTGTCGGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCAGTGCCAACCCTCCACCCTGCACAACCACAACTGTGCCAACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTCCAGCTCTGGAGAGGAGAGCCACAGTGAATCCGATGATGATGAAGATGAGGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATCGACGTGGTCACAGTGGAGAAAAGGCGCATCTCCTGCAACAAA
                                                  Xl3.1-CHK-1012693484         AGTGCGAGGACTGGGCTGGGACTGACACACACACACACACACTTACACACACAACAGAGAGAGAGAGGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGAGCCCAAAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAAGATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTCCCCATCCACCCAGTTCAACAGTGGGCAGCTCTGTGTCGGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCAGTGCCAACCCTCCACCCTGCACAACCACAACTGTGCCAACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTCCAGCTCTGGAGAGGAGAGCCACAGTGAATCCGATGATGATGAAGATGAGGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATCGACGTGGTCACAGTGGAGAAAAGGCGCATCTCCTGC
                                                      consensus depths        4     4     4     4     4     4     4     4     4     5     4     6     4     6     4     7     4     7     4     7     5     8     5     8     5     8     5     8     6     8     6     8     5     8     5     8     5     7     5     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     8     7     7     7     7     6     7     7     7     7     7     7     7     6     6     6     6     5     6     6     6     6     6     6     6     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                               ----T-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                       --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----T--C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------C
                                               BLH ATG     273     542   
                                               BLH MIN     273      76   
                                               BLH MPR     225      76   
                                               BLH OVR     273      69   
                                               CDS MIN     273      76   
                                               EST CLI      -2      29   
                                               ORF LNG     273       3   
                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 3e-011     NP_001071767.1 transcription factor protein [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sp ==== 9e-015     NP_999744.1 myc protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---- 1e-030     XP_874112.3 PREDICTED: similar to N-myc protein [Bos taurus] ----------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bt ---- 8e-036     NP_001039539.1 myc proto-oncogene protein [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Cf ---- 1e-035     NP_001003246.2 myc proto-oncogene protein [Canis lupus familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 3e-060     NP_005369.2 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived; OncogeneNMYC; v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived[Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 3e-065     NP_997779.1 zgc:85706; v-myc myelocytomatosis viral related oncogene, neuroblastoma derived(avian); wu:fb57a02 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 2e-065     NP_032735.3 neuroblastoma myc-related oncogene 1 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 2e-072     NP_001026262.1 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 1e-145     NP_001006874.1 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 9e-158     AAI67562.1 Unknown (protein for MGC:181855) [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl232d19.5                                                                                                                                                                        TAA---------------------------------------------------------TGA---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Tbd7 5g3  out                        XL063l05.5p GGGCTGACAGTGCGAGGACTGGGCTGGGACTGacacacacacacacacacttacacacacaacagagagagagagGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGAGCCCAAAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAAGATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTNCAGAAGCTGACCT
  5   1   2       bld DMZ  5g3  out                        xl232d19.5p   GCTGACAGTGCGAGGACTGGGCTGGGACTGacacacacacacacacacttacacacacaacagagagagagagGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGAGCCCAAAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAAGATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAANCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTC
  5   1   2       bld DMZ  5g                              xl233d19.5p   GCTGACAGTGCGAGGACTGGGCTGGGACTGacacacacacacacacacttacacacacaacagagagagagagGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGANCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGANCCCAAAGGTTGGCACTAAGATGCCNGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAANATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAANTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCNTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGNGATTCAGTGGACTGGGNATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCA
  5   1   2      seed DMZ  5g3  out                        xl233p24.5p   GCTGACAGTGCGAGGACTGGGCTGGGACTGacacacacacacacacacttacacacacaacagagagagagagGGCTGCACGGGGAAGCGCAGGGACGGGGCGCACTCGCTGCAATTACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGAGCCACTCACTGAGCTGGAACTGAGGCAGGACACTGGAGCCCAAAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGTTTCTACCCAGATGAAGATGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCA
  5   1   2       bld Neu7      out                        XL038c13.5p                                              CNNCGNNNCTGCAGGNAATTCGGCACGAGGCACTGACACACACACAACAGAGGGGCTGGGGCGCACTCCGTGTAATTACGGGAGGACACTCACTGAGCAAGGACTGGGCGCATTCACTCCACTGTAATTACGGCAAGTGACAAGAGAAGAGGCTGCGAGTATAACACTGCGGGGCCGCTCACTGCGCTGAGACTCAGGCAGGACCCTGGAGCCTAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATATGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCAGACGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCACCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTCCCCACACCCCCTCTTTCCCCTAGCCGTTCTGGGCTGCACGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCTGAAACTGATCTGCTTGGAGGTTCTAGCTGGGGAGAACTTGGATTGCCCCCCTGCAATGTAAAATCCTTCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGAGAAAAGCTAGAGAGGGCCGTCAGTGAGAAGCTGGGCAAGGCATCATGCACCCCAGAG
  5   1   2       bld Tbd7      out                        XL059i23.5p                                                     ACTGTGTGTGAGGAGNACTGCACTGACACACACACAACAGNAGGGGCTGGGGCGCACTCCGTGTAATTACGGGAGGACACTCAGTGAGCAAGGACTGGGCGCATTCACTCCACTGTAATTACGGCAAGTGACAAGAGAAGAGGCTGCGAGTATAACACTGCGGGGCCGCTCACTGCGCAGTGAGACTCAGGCAGGACCCTGGAGCCTAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATATGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCAGACGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCACCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTCCCCACACCCCCTCTTTCCCCTAGCCGTTCTGGGCTGCACGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGT
  5   1   2      skin Tbd7      out                        XL082l20.5p                                                                             ACACACACAACAGNAGGGCTGGGGCGCACTCCGTGTAATTACGGGNAGGNACACTCACTGNAGCAAGGNACTGGGCGCATTCACTCCACTGTAATTACGGCAAGTGACAAGAGNAAGAGGCTGCGAGTATAACACTGCGGGGCCGCTCACTGCGCTGAGACTCAGGCAGGACCCTGGNAGCCTAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATATGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCAGACGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCACCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTCCCCACACCCCCTCTTTCCCCTAGCCGTTCTGGGCTGCACGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCTGAAACTGATCTGCTTGGAGGTTCTAGCTGGGGAGAACT
  5   1   2       bld Tbd7                                 XL110k03.5p                                                                                                                        ACGGGAGGCCACTCACTGAGCAAAGACTGGGGCGCGCTCGCTTGGCTGTAATTACGGGAAGAGCCGAGGGAAGAGCACAAGCTGCAAACTCACAGCGGANC
  5   1   2       bld Tbd7      out                        XL088b14.5p                                                                                                                                                                                                                                                                                                                                                              TGATTTTTACCTGTGTGACCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTCCCCATCCACCCAGTTCAACAGTGGGCAGCTCTGTGTCGGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCAGTGCCAACCCTCCACCCTGCACAACCACAACTGTGCCAACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTNCAGCTCTGGAGAGGAGAGCCACAGTGAATCCGATGATGATGAAGATGAGGAGGAGGAGGAAGA
  5   1   2       bld Em10                            IMAGE:7979685.5p                                                                                                                                                                                                                                                                                                                                                                                               CCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCCACACCCCCACTTTCCCCAAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCTGAGCTGTTGGTGTTGCCTCCAGAAGCTGACCTGCTTGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTCCCCATCCACCCAGTTCAACAGTGGGCAGCTCTGTGTCGGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCAGTGCCAACCCTCCACCCTGCACAACCACAACTGTGCCAACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTCCAGCTCTGGAGAGGAGAGCCACAGTGAATCcgatgatgatgaagatgaggaggaggaggaagaggatgacgaagaggaAGAATCGACGTGGTCCAGTGGAGAAAGGCGCAACTCCTCCACAATCTGTACGTCCCTACATCACCGTCGACCTAGACACCATCTGTGTCTCGAGACGCCAGATGAGTGTCTCAGCGATCCTCAGTCTCACACACATATCGCTCTCACTCTGAACGAGATGCCACTCAAGACTAGACATGCCGCTATAACG
  5   1   2       bld Tbd7      out                        XL053e23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGGGGAGTAACTNGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTTTNTGCCCGGGNAAAGCTGGAGAGGGCAGTGAGCGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCATTCCCCATCCACCCAGTTCAACAGTGGGCAGCTCTGTGTCGGGGCGTGGGGTGGACATGANTAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCAGTGCCAACCCTCCACCCTGCACAACCACAACTGTGCCAACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTCCAGCtctggagaggagagccacagtgaatccgatgatgatgaagatgaggaggaggaggaagaggatgacgaagaggaagaaATCGACGTGGTCACAGTGGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCCCTTACAATCACCGTTCG
  5   1   2       add Tbd7                                 XL069d08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCCTGCACAACCACAACTGTGCCNACATCCACGACAGCTAGGAATTGCACTCAGCCTTGCACAAGCAGCTCCAGCTCTGGAGAGGAGAGCCACANTGAATCcgatgatgatgaagatgaggaggaggaggaagaggatgacgaagaggaagaaATCGACGTGGTCACAGNGGAGAAAAGGCGCATCTCCTGCAACAAATNTGTNACGTCCCTTACAATCACCGNTCGACCTAAGAACACCATCTTGGTGTCCTCGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)