Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl301a12.3                           29 END     1           8        3                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778847 Xl3.1-IMAGE:8529827.5 - 12 ESTs
                                                                       ...-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8529827.5                                                                                                                                                                                                                                AAGAACCCTTTCCAGGTAACACGTGAGGTCACAGACTATATCAGTGGTGGGGGATTCAGCAATGTCTTCTCCATGCCAGATTATCAGGCTTCTGCTGTGTCCCAATACCTAAAGAACGCCCCAAAACTACCACCCTCGACATACTATAATGGCAGTGGTCGTGCCTATCCTGATGTGGCAGCTCTGTCTGACAACTACTGGGTGGTGACAAACCGTGTGCCCATTCCATGGGTATCAGGAACGTCAGCCTCCACGCCAGTCTTTGGTGGGATACTGTCTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGAGGGGGGGGGGGGTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACGGAGAAGGAAAGCTACGGAGGCAGTTTATTGCCAACAGGTTAGCTGCAATAGTACAGGCTATAAGACTATGTTTATTCTGTAGGGTGCTTTGCC
                                                  Xl3.1-CHK-1012693842                                                                                                                                                                                                                                      CCTTTCCAGGTAACACGTGAGGTCACAGACTATATCAGTGGTGGGGGATTCAGCAATGTCTTCTCCATGCCAGATTATCAGGCTTCTGCTGTGTCCCAATACCTAAAGAACGCCCCAAAACTACCACCCTCGACATACTATAATGGCAGTGGTCGTGCCTATCCTGATGTGGCAGCTCTGTCTGACAACTACTGGGTGGTGACAAACCGTGTGCCCATTCCATGGGTATCAGGAACGTCAGCCTCCACGCCAGTCTTTGGTGGGATACTGTCTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGAGGGGGGGGGGGGTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACGGAGAAGGAAAGCTACGGAGGCAGTTTATTGCCAACAGGTTAGCTGCAATAGTACAGGCTATAAGACTATxTTTxxTCTGTAGGGTGCTTTGCCATGCCT
                                                      consensus depths                                                                                                                                                                                                                                     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     6     4     6     4     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     8     4     7     4     7     3     8     4     8     4     8     4     8     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6     9     6     9     6     9     6     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10     7    10     7    10     7    10     6    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     6    10     6    10     6    10     6     9     5     8     5     8     5     8     5     8     4     7     3     7     3     7     3     5     3     5     3     5     2     5     2     4
  5   1   2       bld Emb4                            IMAGE:5542434.5p CCACACTATCAGTTATGGGGATGATGAGGACAGTCTGTCCGTCGCCTTCATGCAAAGAATCAACGTGGAGTTCATGAAAGCAGCCAGCAGGGGTCTCACCATACTTTTTGCTTCGGGAGATGACGGTGCCGGATGCAGACATGTTGCTGAAGGAAAGAACACCTTCAGGCCAAGTTTCCCAGCTTCCAGCCCATACGTCACTACTGTGGGGGGAACCTCATTTAAGAACCCTTTCCAGGTAACACGTGAGGTCACAGACTATATCAGTGGTGGGGGATTCAGCAATGTCTTCTCCATGCCAGATTATCAGGCTTCTGCTGTGTCCCAATACCTAAAGAACGCCCCAAAACTACCACCCTCGACATACTATAATGGCAGTGGTCGTGCCTATCCTGATGTGGCAGCTCTGTCTGACAACTACTGGGTGGTGACAAACCGTGTGCCCATTCCATGGGTATCAGGAACGTCAGCCTCCACGCCAGTCTTTGGTGGGATACTGTCTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGGACCCGAATTTCCCGGAACTGCTCCCAGCCCTTCTCTTTTGATATCCCAGGAATTGCTCTGTCGTGTGTCGAGGGGGGCGGCCCTCCCCTTTTCCCCGCTTCCGTTACCGCCACGACCTTACGTTCCCCGTTGCTGACCCCGTGCGCATAGACCACCGCGTCCGAGCACTCGCCCCCGTTCGGAGCCTCTCCCCCCCG
  5   1   2      skin Gas5      out                   IMAGE:3747441.5p                                                                                                                                                                                                                                AAGAACCCTTTCCAGGTAACACGTGAGGTCACAGACTATATCAGTGGTGGGGGATTCAGCAATGTCTTCTCCATGCCAGATTATCAGGCTTCTGCTGTGTCCCAATACCTAAAGAACGCCCCAAAACTACCACCCTCGACATACTATAATGGCAGTGGTCGTGCCTATCCTGATGTGGCAGCTCTGTCTGACAACTACTGGGTGGTGACAAACCGTGTGCCCATTCCATGGGTATCAGGAACGTCAGCCTCCACGCCAGTCTTTGGTGGGATACTGTCTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTC
  5   1   2       bld Bone                            IMAGE:8742001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACAAACCGTGTGCCCATTCCATGGGTATCAGGAACGTCAGCCTCCACGCCAGTCTTTGGTGGGATACTGTCTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGTGAgggggggggTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAACCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCCTCCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCGGAAGCTCATTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTTCTGATCAGACATCAGTGAACACATTACGTCCCCCACTAGATTTCATGTCAAGCTATCAATGAACTATCTGGAATAATACCTTACGAATGCTGCTACGAGGCATAATGCCAACGATAGTCCCGTCCAATTAAGTC
  5   1   2       bld Int2                            IMAGE:8529827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGATCAATGACCGGCGCCTACAGAAAGGCCTCTCACCTTTGGGATTTCTCAATCCAGCGCTTTACCGACTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGAggggggggggggTGCTTTTATTTCAAATTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTCACTCTGGTCTGATCAGACATCAGTGACACTTACGTCCCCACTAAA
  5   1   2       bld Emb1                            IMAGE:6866327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGCGTGGGTGCAAGTGAATGGGAGCCAAGCCTTGTATGATGTGACGGAGGGCTGTCACTTGTCCTGTATCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTgggggggggTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAACCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCGGAAGCTCATTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGGCACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGAATAATTACACTTAACGGAAGAAGGAAAGCTACGGAAGCAGTTTTATTGCCCATACATTTGCTGCAATAGTACCGGCTGGGGGGACTGGAATTTGGTTCCGGGG
  5   1   2       bld Int2                            IMAGE:8529116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAANCCAGGTTCTCNTGAAGATCATCAATAANAATCGTCCCCGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGAggggggggggggTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTCATTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCCGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACTGGCTATCTGATATTTCACTTAACGAGAAGGAAGCTACGGAGCAGTTTTTTCCACTAATTACG
  5   1   2       bld Int2                            IMAGE:8529934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATGACCTTGTGTTGGGACAGGGATTCTGTGCCTCCCCCAGTTGGGACCCTGTGACTGGTTGGGGGACCCCGAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGTGTGAgggggggggTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAACCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCCTCCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCCGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTACGGAGAAGGAAGCTATGGAGCAGTTATTGCCACAGATAGCTGCATAGTCAGGCTATAGACTATATTATCTGTAGATGCTTACATACTGATAACAGTCTAGAGTAATCTGTTAGAGCACTGCGTATACTG
  5   1   2       bld Kid                             IMAGE:4031479.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATTTCCCGGAACTGCTCCGAGCCCTTCTCTTTTGATATCCAGGAATTGCTCTGTGTGTGTGAggggggggggTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACggagaaggaaagctacggagggagnttattgccaacaggttagctgcaatagtacaggctataagactatattttattctgtagaatgcttttaccctaccctgagtaataaagctctaagaagttattatctggtttagggatagcagctTGCCCGAATTTAACCTTGGGTGGGGACATTCACTTTTCCTGTCCTGAATCCTCCTCCCCTGGCTTCCCTCCATAAATTCCTGGGGCCTCCATATTTTACACCCAAGNGAAAGGGCGAAGGAGGGGTAAAAAAAGGGAACCCAAAACCTGGGAGCCTTGGGCTTCCAAAAcccccctagacccccccGGGGAGAGGGTTTTTAAAC
  3  -1   2       bld Tbd4                            IMAGE:4059015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGGGGGGTGCTTTTATTTCAGATTCACTTCTTTCTTTCATTGAGTTTTAACCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCCTCCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTNTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTTGGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTACTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCCGGTCTGATCAGAACATCAGTGACACATTACGTNCCCCACTAGAT
  5   1   2       bld Gas8                   IMAGE:3516164-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACggagaaggaaagctacggaggcagtttattgccaacaggttagctgcaatagtacaggctataagactatatttattctgtagaatgctttaccatacctgagtaataagctctagaagttatatctgtttaggatagcagctgccgtattagcttggtgt
  5   1   2      seed Gas8      out                   IMAGE:3516164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACTTCTTTCTTTCATTGAGTTTTAAGCTCTTTTCATTGGCCGTTGTGCTGCACAGACTTGTGGGATTGGCCTAGAGGGGCCCCAGTCTGAAGCTGTCAGACAATTCTATTGGTTCCCCACAGGAGCAGCTGATGGGAATGTCCATCTCACCTGACACATAGAGGCGGGGCTAGATATGATTGACAGCTCACATTTCTAATTACAGGGGTTTCATAAAAACAAGAATTGGGGGTTTCATTTTCTAAGGGATTTTATGATAGAGCTTTTATATGTGGGTGACCGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCCTAATGACCCCCCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACGGAGA
  3   1   2       bld Gas5      out                   IMAGE:3747453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGTCCCCTTTAACTTCTCAGAAGCTTTTCCTCTTTCTCCATCTGATGAATTTCTTCTGTTCNTAATGACCCCNCAATTCCACCTGAACAATTCGGGTAATTCCCAACCTGGACCCCAGGGGAACATTCAGACTCAGATCAGCTGCACATTTCACTCTGGTCTGATCAGAACATCAGTGACACATTACGTCCCCCACTAGATTCCAATGTCACAGCTTAATCACATGACTATCTGATAATTACACTTAACGGAGAAGGAAAGCTACGGAGGCAGTTTATTGCCAACAGGTTAGCTGCAATAGTACAGGCTATAAGACTATGTTTATTCTGTAGGGTGCTTTGCCATGCCTGGGTGGACAGCTCTAGAGGTTATATCTGTTTGGGATGGCAGCTGCCGTATTGGCTTGGTGTGGCATCGCTTCCTGTCTGGGTCTCTCCCTGCTCGCTCGTGGCTCTGGGCTCGGATTGCAGCAGGGGGGGGAGGAGGGAGAGAGGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)