Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL180j14.3.5                         37 END     4          57       10                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012779000 Xl3.1-IMAGE:5156562.5 - 7 ESTs
                                                                       .........-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156562.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAGCTGCAGAACACTGCGTTGACCCGAGGTGGATCAGACTACTTTGTCCAGGATTTGGCTCCATACATCCTACATAACTATAAATATGAGCACAATGCAGGGCCGTATGGTCACCAGATGCCTCCAAGTCATGCCAGATCCCTGTCTTTGGCAGAGGACTCTCAACAGACCAACACTGGTGGCAAACTTAACACATCCTTTATGATTGATTCCCTACTCCATGACCTGCAAGAGGTGGATCTGCCTGATGCCTCCAGGAACCTTGAGAACCAAAGGATCTCTCCGGCTGTAGCCATGAACAATATGTGGAGCTCTGCTCCTCTTCTCTACACTCATTCCAAGCCAACAAGGAATGCCAGAAGCCCTGGTTTGTCCACCATCCATTCCACGTACTCCTCTTCCAGCTCCAGCATTTCTACAATCTCCCCCGTTGGGTTTCAGAAGGAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAGAGACGGAGGCCTCCTGGCCTGACCTGGAGTGAACACTCAATGAAATGAAACCTGGGTACCAGGTGCTTCTGTTCCTACTGACTTCATACATTGCTGTAGATATTGTGGGGCCCATGGTTC
                                                  Xl3.1-CHK-1012699747                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCAGAACACTGCGTTGACCCGAGGTGGATCAGACTACTTTGTCCAGGATTTGGCTCCATACATCCTACATAACTATAAATATGAGCACAATGCAGGGCCGTATGGTCACCAGATGCCTCCAAGTCATGCCAGATCCCTGTCTTTGGCAGAGGACTCTCAACAGACCAACACTGGTGGCAAACTTAACACATCCTTTATGATTGATTCCCTACTCCATGACCTGCAAGAGGTGGATCTGCCTGATGCCTCCAGGAACCTTGAGAACCAAAGGATCTCTCCGGCTGTAGCCATGAACAATATGTGGAGCTCTGCTCCTCTTCTCTACACTCATTCCAAGCCAACAAGGAATGCCAGAAGCCCTGGTTTGTCCACCATCCATTCCACGTACTCCTCTTCCAGCTCCAGCATTTCTACAATCTCCCCCGTTGGGTTTCAGAAGGAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAGAGACGGAGGCCTCCTGGCCTGACCTGGAGTGAACACTCAATGAAATGAAACCTGGGTACCAGGTGCTTCTGTTCCTACTGACTTCATACATTGCTGTAGATATTGTGGGGCCCATGGTTCTGGGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 1e-008     NP_003914.1 forkhead box H1; Human homolog of Xenopus forkhead activin signal transducer-1[Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-009     NP_032015.1 forkhead box H1; forkhead activin signal transducer 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---- 2e-012     XP_001790554.1 PREDICTED: forkhead box H1 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Dr ---- 2e-024     NP_571577.1 forkhead box H1; etID62177.12 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Xt ---- 9e-158     Q28GC4 Forkhead box protein H1 (Forkhead activin signal transducer 1) (Fast-1) [Xenopus tropicalis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       FRAGMENT -- Xl ---- 0          S71800 transcription factor FAST-1 - African clawed frog (fragment) [Xenopus laevis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5156562.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------------------------ATG---TGA------------------------------TGA---------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Tbd7      out                        XL093c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGACCCTGGAAAGCCCCAGGCCAGGGTAACTTCTGGACGGTGGATGTGAGCCGGATTCCTCTGGATGCGATGAAGCTGCAGAACACTGCGTTGACCCGAGGTGGATCAGACTACTTTGTCCAGGATTTGGCTCCATACATCCTACATAACTATAAATATGAGCACAATGCAGGGCCGTATGGTCACCAGATGCCTCCAAGTCATGCCAGATCCCTGTCTTTGGCAGAGGACTCTCAACAGACCAACACTGGTGGCAAACTTAACACATCCTTTATGATTGATTCCCTACTCCATGACCTGCAAGAGGTGGATCTGCCTGATGCCTCCAGGAACCTTGAGAACCAAAGGATCTCTCCGGCTGTAGCCATGAACAATATGTGGAGCTCTGCTCCTCTTCTCTACACTCATTCCAAGCCAACAAGGAATGCCAGAAGCCCTGGTTTGT
  5   1   2       bld Oo1                             IMAGE:6638909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAGCTGCAGAACACTGCGTTGACCCGAGGTGGATCAGACTACTTTGTCCAGGATTTGGCTCCATACATCCTACATAACTATAAATATGAGCACAATGCAGGGGCGTATGGTCACCAGATGCCTCCAAGTCATGCCAGATCCCTGTCTTTGGCAGAGGACTCTCAACAGACCAACACTGGTGGCAAACTTAACACATCCTTTATGATTGATTCCCTACTCCATGACCTGCAAGAGGTGGATCTGCCTGATGCCTCCAGGAACCTTGAGAACCAAAGGATCTCTCCGGCTGTAGCCATGAACAATATGTGGAGCTCTGCTCCTCTTCTCTACACTCATTCCAAGCCAACAAGGAATGCCAGAAGCCCTGGTTTGTCCACCATCCATTCCACGTACTCCTCTTCCAGCTCCAGCATTTCTACAATCTCCCCCGTTGGGTTTCAGAAGGAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGGACCCCAATCTCCTCTGGGACTAGACAACATGTTACGGGCCATGCCACCCCAACAAAGAGTGC
  5   1   2       bld Gas5      out                   IMAGE:3750749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGCCGTATGGTCACCAGATGCCTCCAAGTCATGCCAGATCCCTGTCTTTGGCAGAGGACTCTCAACAGACCAACACTGGTGGTAAACTTAACACATCCTTTATGATTGATTCCCTACTCCATGACCTGCAAGAGGTGGATCTGCCTGATGCCTCCAGGAACCTTGAGAACCAAAGGATCTCTCCGGCTGTAGCCATGAACAATATGTGGAGCTCTGCTCCTCTTCTCTACACTCATTCCAAGCCAACAAGGAATGCCAGAAGCCCTGGTTTGTCCACCATCCATTCCACGTACTCCTCTTCCAGCTCCAGCATTTCTACAATCTCCCCCGTTGGGTTTCAGAAGGAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATAGGACTTGCCC
  5   1   2       bld Ov1       out                   IMAGE:5073494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGAGGAATGCCAGAAGCCCTGGTTTGTCCACCATCCATTCCACGTACTCCTCTTCCAGCTCCAGCATTTCTACAATCTCCCCCGTTGGGTTTCAGAAGGAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAG
  5   1   2      seed Ga15                               XL499m07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAGAGACGGAGGCCTCCTGGCCTGACCTGGAGTGAACACTCAATGAAATGAAACCTGGGTACCAGGTGCTTCTGTTCCTACTGACTTCATACATTGCTGTAGATATTGTGGGGCCCATGGTTCTGGGAGTAGTGGGTGGTTGGAGGGTTGNTTA
  5   1   2       bld Emb1                            IMAGE:5156562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGGAGAAAAGTGGTCGACAAACTCAAAGGGTTGGCCATCCCATTAAACGATCAAGAGAGGACGATGACTGCAGTACCACATCTTCAGATCCTGACACTGGGAACTACTCTCCCATTGAGCCCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAGAGACGGAGGCCTCCTGGCCTGACCTGGAGTGAACACTCAATGAAATGAAACCTGGGTACCAGGTGCTTCTGTTCCTACTGACTTCATACATTGCTGTAGATATTGTGGGGCCCATGGTTCTGGGAGTANTGGGTGGNNTTGGNNAAGGTTTGTTTACAGCAGGGAGGAAACCAGATCTAAAGTGGttttttttATATTTCTGCCATTTTAATCCCTGTCTGGGTTCTGCCAGGAAACTGAACGGGGGTCTTTGTACCCTACCTATTGCACTAATGGTTGAGTTGCTGTGGGGCCCCATCATGTTACTCTGCAGCCCCCTCTTGGCAAGGGATACTGGGGAGGGCTGAACATTGAAGTGGGCCTGAATAACCAATTGCTTGATAACCAGTCCCCTGGTGCCCACCAGTACCGATTGTC
  5   1   2       bld Ooc2      out                   IMAGE:3745900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCAAAGAAGATGCCCTTGCTTTCATTGGACTTGCCCACTTCTTACACAAAGAGTGTGGCACCTAATGTAGTGGCACCACCAAGTGTCCTGCCCTTCTTTCATTTTCCTCGCTTCACCTACTATAATTATGGACCTTCACCCTACATGACCCCACCATACTGGGGTTTTCCACATCCTACAAATTCTGGTGGGGATAGTCCACGTGGACCCCAATCTCCTCTGGACCTAGACAACATGTTACGGGCCATGCCACCCAACAAGAGTGTGTTTGATGTGTTGACAAGTCACCCAGGTGACCTCGTCCATCCGTCCTTCCTCAGTCAATGCTTGGGCAGCAGTGGTTCCCCGTACCCAAGCAGACAAGGCCTTATGTAGAGACGGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)