Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk144m09ex.3.5                      13 END     2          25       15                Unknown (protein for IMAGE:7547409) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012779189 Xl3.1-xl272m03.5 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl272m03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAAAGGCACCGGATTTCAGGCGCAATGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTAAAAAAAAACCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGACTAAGAGAAACCGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATATTACAGAGTTACTGTGG
                                                  Xl3.1-CHK-1012698707                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCACCGGATTTCAGGCGCAATGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTAAAAAAAAACCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGACTAAGAGAAACCGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATxxTxxxxxxxTACTGTGGAACCTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     2     4     2     4     2     4     2     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A---G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                               BLH MIN      35       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Sp ---- 8e-014     XP_001196520.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl272m03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
  5   1   2       bld Oo1                             IMAGE:5078583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTAAGCTCTGAATGCAGAGACAGGGGTTTCCGGAAGGCAATCTTTGGGGCGGGTCACGTGATAGTGATATCACGAAAGTCCCATTTGCCACTGTGTTCTAGTAGTAAAGGGGCAGAAAAGGCACCGGATTTCAGGCGCAATGGCTGACAGTGAAACCCAACCTGTAGAAGTAACCCCTGCAAATGAAGACAGTAGTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCGTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGT
  5   1   2      seed Oo1                             IMAGE:6637566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTGGTACCGGTCCGGATTCCTGCCAGAAAGGACCGGATTTCAGGGTTACTCGCTGACAGTGAAACCCAACCTGTAGAAGTAACCCCTGCAAATGAAGACAGTAGTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCGTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGACTAAGAGAAACTGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATATTACAGAGTTACTGTGGAACCTACCGATCCCGACTGGCCTTTTGACCTGAAGGGAAATGGAGATCATGCTGGAGTTCCCTGATGATTATCCCTTAAAGATTTTTACAGTCCCAGATTCCTGNAAGATCCAGATTTACCTCCCTGTTATGGGCAGACCTGTATGTGAAAGCATCCTCTAGCATGGTTAGAAAGCCAACATGCCACCCAATCAGCTGATTGGTAAAATGGGAGCCTTTTGTTCCCCACCTTATCTGGCACTGGCCTTGATCGCCA
  5   1   2       bld Tbd1                                 AW765102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGGGGCAGAAAAGGCACCGGATTTCAGGCGCAATGGCTGACAGTGAAACCCAACCTGTAGAAGTAACCCCTGCAAATGAAGACAGTAGTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCGTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAA
  5   1   2       bld DMZ                                  xl272m03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAAAGGCACCGGATTTCAGGCGCAATGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTTCTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCTCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGAGTTGGTGATGTAACCCTAGATGTGGCTAAAAGACTAAGAGAAACCGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATATTACAGAGTAACTGTGGAACCTACA
  5   1   2       bld Ov1                             IMAGE:6317092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCACCGGATTTCAGGCGCAATGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTTCTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTANATAATGTTCCTCCTATGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGATTAAGAGAAACCGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATATTACAGAGTAACTGTGGAACCTACAGATCCAGACTGGCCTTTTGACCTGAAGGAAATGGAGATCATGCTGGGAGTTTCCTGATGATTATCCCTTTAAAGATTTTTACAGTTCCAGATTCCCTGGAAAATCAAGAATTTACCTCCCTGGTTATGGGGCAGAACATGGAATGA
  5   1   2       bld Egg4                   IMAGE:3744445-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGATTTCAGGCGCAAGGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAAATGTCGATTTCTCCATCAACTTGCAGATTGCCAACTTTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAAATTTCTGAAAAAAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTATGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGATTAAGAGAAACCGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAAGATAAAGTTATTGTCCAGGAAAGAGATGATGGAGAGGTTACATATTACAGAGTAACT
  5   1   2       bld Egg4      out                   IMAGE:3744445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCAATGGCTGACAGTGATATGCAACCTGTAGAAGTACCCCCTGCAAATGAAGACGGTATTGTTTGCAGCCAAGAAAAATCTCACCGCCAACAGCATCAACACCTTTGCAGGTTTTTCTCCCAGGGACGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTTCTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCTTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTATGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGT
  5   1   2       bld Tbd7      out                        XL072i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGATACTGCCGGTTTGGTAGTAGATGTCGATTTCTCCATCAACTTGCAGATTGCCAACATTCTGAGAAGAATCGGAAGCAAAATGTTTCATGTGAGATTACTGAGAAGAGCAATGCAGCTGAAATATCCTGTTCCACAAACAAAGCGTATTCTGGTCCATTaaaaaaaaaCCTGGAAACTCATCAAAGAAAATACCGCCCCCGAAAACTATGTCGCTACTTTGCTTCTGGATATTGTGCCATGGAAAACCACTGTAAGTTTTGGCACCCTGACAGCCTTCCACCACTAAATAATGTTCCTCCTGTGGACAAAAAGGCAACTACTAGCAGTACTAAGGCTAGGTTGCCAGTAGAGAGGCCTCAAGCACTTCCAGAGGGTCTTAGATTTGGTGATGTAACCCTAGATGTGGCTAAAAGACTAAGAGAAACTGAAATTTCCCAATTGTTAAAGAGGTTTCCAAAAGATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)