Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6864338.5                       7 END     3          50       42                hypothetical protein LOC495078 [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:5541913.5                       5 END     1          16       20                eomesodermin [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk164i12ex.3                        11 PI      90        173      933                hypothetical protein LOC495078 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012779359 Xl3.1-xlk147g13ex.3 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk147g13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGNAGAGGTTCTACCTATCAGAGGAAAATGACAACAAGTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGNTTTCTCAGAAGATCTCCTACCTAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCCTGGGTAGAAACCCCTCCCTCCATTAAATCACTAGACTCTAATGATTCAGGGGTGTATACGGGTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCNCCTCAAGCAATGAAANCTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTACCTTGCTTTCCTTTTTGTTATGTCATGTATATATGCGG
                                                  Xl3.1-CHK-1012702515                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTCTACCTATCAGAGGAAAATGACAACAAGTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGNTTTCTCAGAAGATCTCCTACCTAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCCTGGGTAGAAACCCCTCCCTCCATTAAATCACTAGACTCTAATGATTCAGGGGTGTATACGGGTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCNCCTCAAGCAATGAAANCTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTACCTTGCTTTCCTTTTTGTTATGTCATGTATAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     2     4     4     4     3     4     2     4     4     4     4     4     4     4     4     4     3     4     4     4     3     4     4     4     4     4     4     5     3     6     4     6     4     6     5     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     4     5     5     5     5     5     2     4
                                                                       ...PROTEIN --- Dr ---- 5e-028     NP_571754.3 eomesodermin homolog [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-038     NP_034266.2 eomesodermin homolog [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 1e-039     XP_001251930.1 PREDICTED: similar to eomesodermin [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-039     NP_005433.2 eomesodermin; t box, brain, 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 7e-040     XP_850738.1 PREDICTED: similar to eomesodermin isoform 2 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         PREDICTED - Gg ---- 3e-044     XP_426003.2 PREDICTED: similar to eomesodermin [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-055     NP_001122124.1 eomesodermin [Xenopus (Silurana) tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 4e-056     NP_001081810.1 eomesodermin [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk147g13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------ATG------TAA---------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAG---------------------------TAA---------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATG------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                               ]
  3   1   2       bld Ga18      out                     xlk155l18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCACCTNNNGCANTNANNNNCTGNCNNNCNAACNNNCCACCNAATGGCCTNCTACCNAGATGCAGCNTTTGCNNNCATGGCAGGCTGGGGANGNAGANGTTNNTNCNTATNAGAGGAAAATGACAACAANTTTNNCTTNNTCNTCAAGGTCAAGTCCTTCAGNTTTCTCAGAAGATCTCCTNCCTAAGGACAAGNTCAAGGAAGAGATGAGCTCTTCCTGGGTAGAANNCCCTCCNTCCATTAANTCACTAGNCTCTAATGATTCAGGGGTGTATACGGGTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCNCCTCAAGCAATGAAANCTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTACCTTNCTTTCCTTTTTGTTATGTCATGTATATANNCTGGCA
  3   1   2       bld Ga18      out                     xlk147g13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCCCNNCCAANNNNCCCNCCNAATNGCCTNCTACCCAGATGCANCCTTTNCCNCCATGGCAGNCTGGGGAAGCAGAGNTTCTNCCTATCAGAGGAAAATGACAACAAGTTTACCTTGGNCCTCAAGNTCAAGTCCTTCAGNTTTCTCAGAAGATCTCCTACCTAAGGACAAGNTCAAGNNAGAGATGAGCTCTTCCTGGGTAGAANCCCCTCCCTCCATTAAATCACTAGACTCTAATGATTCAGGGGTGTATNNNNNTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAANCTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTNCCTTGCTTTCCTTTTTGTTATGTCATGTATATATNCTG
  3   1   2      seed Ga18      in                      xlk159a04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGATGCANNCTTTGCCNCCATGNNAGGCTGGGGAAGNAGAGGTTCTACNTATCAGAGGNAAATGACAACAAGTTTNCCTTGGTCCNCAAGNTCAAGTCCTTCAGNTTTCTCAGAAGNTCTCCTACCTAAGGACAAGGTCAAGGNAGAGATGAGCTCTTCCTGGGTAGAAACCCCTCCCTCCATTAANTCACTAGACTCTAATGATTCAGGGGTGTATACGGGTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCNCCTCAAGCAATGAAANCTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTNNCTTNCTTTCCTTTTTGTTATGTCATGTATATANNCTGGC
  5   1   2       add Ga18      in                      xlk159a04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGCAGCCTTTNNCTCCATGGNAGGCTGGGGAAGNAGAGGTTCTACCTATCAGAGGAAAATGACAACAAGTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCTAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCCTGGGTAGAAACCCCTCCCTCCATTAAATCACTAGACTCTAATGATTCAGGGGTGTATACGGGTGCATGTAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCCCCTCCTATAAAATGTGAAGACATTGGCACTGAGGACTATAAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTAtttttattttttCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGNTttataaatatatatatatgtatatagttgttattatatatatttataaatgtataaatatatataattattattattattattatgttttatttatGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGNNGGGNTGTATATTNTATTAGTGGCACACAGCTGTATATTTCTAGAGTAGGNGGNNATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGANTTCTATTTAAAACTTGNCTCTTAAGGCAAANCTTNTACAAATGTAAAGNCCAGTACTGAATGT
  3   1   2       bld Ga18      out                      xlk58i01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGNTTNAGGGGNNNATNNGGGNNNATGTANNANNGGANGNNNNTCCCCTAGCNCCTCAAGCAATGAAACTCCCCTCCTATAAAANGTGAAGACATTGGCACTGAGGNCTATAAAGATGNCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATANCTTCGGGGATGGNNCCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTACCTTGCTTTCCTTTTTGTTATGTCATGTATATATG
  3   1   2       bld FaBN      out                   IMAGE:8074451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATAGATCTATGATCAGGGGTATACGGTGCAGTAGAGAGGAGCTCTCCCTGCACTCAAGCAAGAAACTCCCCTCCTTAAAAGGAAGACATGGCATGAGGACTATAAGATGCCACTAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTAATATGCTGTATTAATATATAACTTCGGGGATGGACCATTGTATATGCCAAAAAGTGGGTTTGCATTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTTTTATTTTTTCAGGAAATGGAATAAACTTGGCACTAATGAGCAAAACAAAACAGGTTTTATAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATTATTATTATGTTTTATTTATGGCACAAAAAGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTATCTGACATTAAATGCACTGGTGGGTTGTATATTGTATTAGTGGCACACAGCTGTATATTTCTAGAGTTAGGTGGCAATGTCAGATTGTATTTTCCACTTTGTCTTGAAAGATTTCTATTTAAAACTTGTCTCTTAAGGCAAATCTTGTACAAATGTAAAGTCCAGTACTGAATGTTCCAGAGTGGGACGCATTGTGGGTTTACCTTGCTTTCCTTTTTGTTATGTCATGTATATATGCGGCANNTATTGTACCTTTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)