Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012780366 Xl3.1-IMAGE:8740122.3 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8740122.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGCGGAGTTGGGATGCATCATGTGCATGTTGATGTGAATGCTCACTCTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCCTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTAACACACACAGGCTTTATTAAAATGGCTTATTTTGAAAAAAA
                                                  Xl3.1-CHK-1012697865                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTTGGGATGCATCATGTGCATGTTGATGTGAATGCTCACTCTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCCTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTAACACACACAGGCTTTATTAAAATGGCTTATTTTGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     7     7     8     7     8     7     8     6     8     7     8     7     8     7     8     6     8     6     8     7     8     7     8     6     8     7     8     6     8     7     8     7     8     5     7     5     7     4     6     4     6     2     3     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 4e-014     NP_650440.1 CG4334 CG4334-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-014     XP_645880.1 hypothetical protein DDBDRAFT_0190179 [Dictyostelium discoideum AX4] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 5e-015     XP_309469.4 AGAP011178-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-025     NP_491660.1 solute carrier family 39 member 1 (1G238) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 4e-029     XP_001183261.1 PREDICTED: similar to zinc transporter [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Cf ---- 1e-036     XP_547574.1 PREDICTED: similar to solute carrier family 39 (zinc transporter), member 1 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 6e-037     NP_001030458.1 hypothetical protein LOC530352 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 7e-037     NP_055252.2 solute carrier family 39 (zinc transporter), member 1; zinc-iron regulatedtransporter-like gene; solute carrier family 39 (zinc transporter), member 3;zinc/iron regulated transporter-like [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 4e-037     NP_038929.2 solute carrier family 39 (zinc transporter), member 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 3e-037     NP_997748.2 solute carrier family 39 (zinc transporter), member 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 2e-072     AAI60573.1 Slc39a1 protein [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 1e-088     AAH91723.1 Unknown (protein for IMAGE:5505990) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8740122.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  3   1   2       bld Bone                            IMAGE:8740122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGTTATACTGGCCTTTTATACAAGACGTTTCAGTACATACCATGCAGTCCTGCAAGCTATCATGCATGGTTTTTCTGGTGTGATAATGAGCAGTTGCATGGTTACAGAACAGCGCTACTCGAGGAGACGATGCTGCTGGGGTCGCGCTTCGTAACACAGCCGAAGTTGGGATGCATCATGTGCATGTTGATGTGAATGCTCACTCTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCTTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTTTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTAACACA
  5  -1   2      skin Sp1                             IMAGE:5505990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     NGTTCAGCATGTTTCTGTGTGTATGACAGTGCATGGTACAGACAGCCGCTACTCGAGGAGACGATGCCTGCTGGTCGCCCGCTCGTACACAGCGAGTGGGATGCATCATGTGCATGTGATGTGATGCTCACTCTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCCTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATTGCTGCTGTCCTCTTCATCAAGATCTGATTAACTCTTTCACAGCCCTGCCAATCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTATGCTAAAGAATATTTTGTAATATTTATGTACGGATCTATTTTTATTATACCAATGCCATTTGTATACAGTATACTCACGTAGTTACTAACAAGCTGTTCTTTGGTACCTAACACACAGGC
  5   1   2       bld Ga15      in                       XL445g15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGCTACTCGGAGGAGACGGATGCCCTGCTGGGGTCGCCCGGCCTCGTACACAGCGGAGTTGGGATGCATCATGTGCATGTTGATGTGAATGCTCACTCTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCCTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAANAAACAACAATTANGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCNTTCAAACNAANTANGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAANAATATTTTGTAATATTTATATACNGATCTATTTTTATTATACCAATGCCATTT
  3   1   2      seed Ga15      in                       XL445g15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGTACACAGCGGAGTTGGGATGCATCATGTGCATGTTGATGTGAATGCTCACTNTGCAGTGAGAACTATGGCACTGATCCTGTCCCTGTCGCTGCACTCGGCCATGGAAGGTGTGGCCCTGGGGCTCCAGCAGGGACGTGGAGAGGTACTGAAGAGCTGCCTGGCTCTGCTTGTCCATAAGAGCATCATGTCCTTCAGTCTGATCCTGAGGCTGGGACAGGGGCGCCTGCACATCCGGGCCATGCTGGTGTGTCTCTTCTTTTACTCCTTTATGTGCCCACTGGGCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCT
  3   1   2       bld Emb9                            IMAGE:7973891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTCCATTTAGAGCTTCAATTCCTTCAGTCTGATCATGAGGTTGTGACAGTTGCGCATGTACTTCCGGGACATGCATGTTTTTCTAATCATTTATTACATTAAAAACCCACTGGGCGTTGGGCTTGGCATTGTATGGGAAGGCAGGCAGACCCAGTGGAACAGTTAACCAGCAGTGTCCTAGAGGGAATGGCTAATGGAGCATTTCTAAACTTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCACATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTTAACAAACAACCC
  3   1   2       bld Eye1                            IMAGE:4743434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATTGGGCTTGGCATTGCATGGGCTGGGCAGGCAGACCCCAGTGGAACAGTTAACCCGCAGTGTCCTGGAGGGAATGGCTACTGGGGCATTTCTATACGTGACCTTCCTGGAGATCCTGCCCCATGAGCTGAGCTCTCACCACCCTCAGATCGACAGAGTCCTCGTGTTGCTTTGTGGCTTCTCTGCGATCGCTGCTGTCCTCTTCATCAAGATCTGATCTTTCACAGCCCTGCCAATCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAAAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTTTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAAAATATTTTGTAATATTTAAAAACGGATCTATTTTTATTAAACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTTTTTGGTACCTAACACACACAGGCTTTATTAAAATGGCTTATTTTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ga12      in                         XL197h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACAGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCTTTATATTTCTGCTTTGCTAAAGAATATTTTGTAATATTTATATACGGATCTATTTTTATTATACCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTAACACACACAGG
  5   1   2       bld Ga12      in                         XL197h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTGCCAAGCTACCCCTGCTGCCATTCCTAACTGTCACTTCCTAAGAAACAACAATTAGGACCAAATGACAGGAAAAATGTGTGGGGTGCGTCTGCGTTCAAACGAAGTAGGGTTAAACTTGCCCtttatatttctgctttgctaaagaatattttgtaatatttatatacggatctatttttattataCCAATGCCATTTGTATACTCACGTAGTTACTAACAAGCCCTTCTTTGGTACCTAACACACACAGGCTTTATTAAAATGGCTTATTTTGaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)