Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5505822.5                       4 PI      86        688      854                Homeo box B3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012780568 Xl3.1-XL103e12.3 - 13 ESTs
                                                                       ..-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL103e12.3                                                                                                                                     TTCCCCAAATGGAGCAGTACCTGCACAATTCGTTTGGGACTGGATCACACCAAATAGGACACTGTCCTAAAAAGGTCAAATATAAAAGCAAGGAGCACGTAAATAAGGTCACGTGACTGGCCCTAGAAGACCAGCCTTTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTTACACTTATGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCAGGCAGAATTCCAAGCAGAAGAACTCCAGCAGCACCCCTCCAGGCGAGAACTGCGAGGAGAAGAGCCCAACTGGCCCTTCCTCTAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAATTTACTGAACCTCACTGAACGCCAGATCAAGATCTGGTTCCAGAACCGCAGAATGAAATACAAGAAGGATCAGAAAGCCAAAGGGATCATGCACTCCCCCGCGGGCCAGTCCCCAGACAGGAGCCCACCGCTCAGTGGATCCAACCATGTGGGATACTCCAGCCAACTATCAACTGTGAATAGCCTCAGCTACGATGCCCCTTCCCCAACCTCTTTTGCCAAATCCCAACAAAACATGTATGGGCTGGCTGCTTACACAGCACCTCTGAGCAGCTGCTTACCCCAGCAGAAAAGATACCCGGGGGCAGAGTATGAGCATCACACCATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGT
                                                  Xl3.1-CHK-1012693336                                                                                                                                           AAATGGAGCAGTACCTGCACAATTCGTTTGGGACTGGATCACACCAAATAGGACACTGTCCTAAAAAGGTCAAATATAAAAGCAAGGAGCACGTAAATAAGGTCACGTGACTGGCCCTAGAAGACCAGCCTTTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTTACACTTATGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCAGGCAGAATTCCAAGCAGAAGAACTCCAGCAGCACCCCTCCAGGCGAGAACTGCGAGGAGAAGAGCCCAACTGGCCCTTCCTCTAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAATTTACTGAACCTCACTGAACGCCAGATCAAGATCTGGTTCCAGAACCGCAGAAxxAxxxAxxAxAAGGATCAGAAAGCCAAAGGGATCATGCACTCCCCCGCGGGCCAGTCCCCAGACAGGAGCCCACCGCTCAGTGGATCCAACCATGTGGGATACTCCxxxxxxxxxxxxACTGTGAATAGCCTCAGCTACGATGCCCCTTCCCCAACCTCTTTTGCCAAATCCCAACAAAACATGTATGGGCTGGCTGCTTACACAGCACCTCTGAGCAGCTGCTTACCCCAGCAGAAAAGATACCCGGGGGCAGAGTATGAGCATCACACCATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGTGTTTGG
                                                      consensus depths                                                                                                                                          3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     4     1     4     1     4     1     4     1     4     1     4     1     4     1     4     2     4     2     4     2     4     2     4     2     4     3     5     2     5     4     6     4     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     4
                                               BLH ATG     147     873                                                                                                                                     
                                               BLH MIN     147     161                                                                                                                                     
                                               BLH OVR     147     899                                                                                                                                     
                                               ORF LNG     147      43                                                                                                                                     
  3  -1   2       bld Sp1                             IMAGE:5435811.3p CGTAACTTGGCCCCTCGAGGATACTCTTTGCGGCCGCTCGCGATCTAGAAACTAGTTCTCTTAACAACCAGCCACATTCTCTCTGCTGGATCTGCTGCTGCTGCTGCTGCACAAGGAGACAAATAATAAAGTTTCCCCAAATGGAGCAGTACCTGCACAATTCGTTTGGGACTGGATCACACCAAATAGGACACTGTCCTAAAAAGGTCAAATATAAAAGCAAGGAGCACGTAAATAAGGTCACGTGACTGGCCCTAGAAGACCAGCCTTTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTTACACTTATGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTC
  5   1   2       bld Neu7 5g3  in                         XL013k19.5p             CTGCTTTCCGNGNCCTCCTTTGCTAGTTTGATNCCGTTAGAAACCTGATTACCTCGAACATGGCTAATGGATTACAGATCGCAGTCTGTCTGTGCGCTAGGAAGCGTCTACTGCAAGGGTTTCCCCAAATGGAGCAGTACCTGCACAATTCGTTTGGGACTGGATCACACCAAATAGGACACTGTCCTAAAAAGGTGGGGTGTAAAAGCAAGGAGCACGTAAATAAGGTCACGTGACTGGCCCTAGAAGACCAGCCTTTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTTACACTTATGCTAANCCAGAATCCTACANC
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8533049.5p                                                       GNGTACCGAAAGAATTCGTCCCCGGGAAGGAAATGTGGTGAGATATGTGCAGGTATGAAAAGGCCAAGCCAGACAGGTTTCCCCAAATGGAGCAGTACCTGCACAATTCGTTTGGGACTGGATCACACCAAATAGGACACTGTCCTAAAAAGGTCAAATACAAAAGCAAGGAGCACGTAAATAAGGTCACGTGACTGGCCCTAGAAGACCAGCCTTTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTTACACTTATGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCCAGCAGAATTCCAGCAGAAGAACTCAGCAGCACCCCTCAGCANGCGAGACTGCGAGGAGAGAGCCNACTGCCNNTCTCTAGCGATCGCACGCGTACCAGCCGCACTGGTGACTGAGAAGAGTCACTTACNCTACTGTGCGCCAGAGGTGAATGCATTACGACTCTGACCGATCAATG
  5   1   2       bld Neu4 5g3  in                    IMAGE:4084844.5p                                                                                                                                                                                                                                                                              TTGGAAGTCAATGTTCATTGATAAGGGTGCCAGTCCCCTACCAATACGAGAGGCCAAGATGCAGAAAACAGCTTATTATGAAAACTCCGGACTGTTTGGAGGTGGGACTTATGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACACTCCAGTCTAGACAACGACTATTCCAGCACTGCCTGCTCTGTCCAGCCAGCTGTTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTCTGAGG
  5   1   2      skin Neu6                   IMAGE:4084844-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                            TTGCTAAGCCAGAATCCTACAGCTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCAGGCAGAATTCCAAGCAGAAGAACTCCAGCAGCACCCCTCCAGCAGGCGAGAACTGCGAGGAGAAGAGCCCAACTGGCCCTTCCTCTAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAATTTACTGAACCTCACTGAACGCCAGATCAAGATCTGGTTCCAGAACCGCAGAATGAAATATAAGAAGGATCAGAAAAGCCAAAGGGATCATGCA
  5   1   2      skin Kid                             IMAGE:7008687.5p                                                                                                                                                                                                                                                                                                                                                                                                                  CTACGGGCCCAGCCAGCAGCAGTACCCACAATCCAGTCTAGACAACGACTATCCCAGCACTGCCTGCTCTGTCCAGCCAGCTGCTATAAGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATAGCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCAGGCAGAATTCCAAGCAGAAGAACTCCAGCAGCACCCCTCCAGGCGAGAACTGCGAGGAGAAGAGCCCAACTGGCCCTTCCTCTAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAATTTACTGAACCTCACTGAACGCCAGATCAAGATCTGGTTCCAGAACCGCAGAATGAAATATAAGAAGGATCAGAAAGCCAAAGGGATCATGCACTCCCCCACAGGCCAGTCCCCAGACAGGAGCCCACCACTCAGTGGACCCACCTTGTGGGATATCCAGCCAGCTACCGACTGTGAATAGCCTCAGCTATGATGCTCCTTCCCAACCTCCTTTGCAATCCCACAAACATGTAGG
  5   1   2       bld Tad1                            IMAGE:6938505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGGCCCCCAACCACAAAACCAATGATATTAGTAACAGTTGTATGAGGACAACGTCAAGTCAGAACTCCAACCAGACCCCAAGTATTAGCAACCAGCAGCACCAGGCCCCATCTCTGCCCCCTTCCTCACCCAGTCATAGCAATACCTCTGCCCAGAAAAAGAGCAAGTCGTCCAATTCATCCGGCTCTTCCCAGTCCACAATGAATAAACAGATATTCCCATGGATGAAGGAGTCCAGGCAGAATTCCAAGCAGAAGAACTCCAGCAGCACCCCTCCAGGCGAGAACTGCGAGGAGAAGAGCCCAACTGGCCCTTCCTCTAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAAGGTGGGAGATGGCCAATTTACTGAACCTCACTGAACGCCAGATCAAGATCTGGTTTCCACAACCGCAAAAATGAAATATTAAGAAGGGATCCGGAAAGCCAAAGGGGATCATTGCACTccccccccaaggccagtcccccaagacaaggaagcccccccACTTCAGGGGGAACCCAAACCTTGGTGGGGAAAACTTCCAATCCAGCCAACCCAAACGGTGGAATAACCCCCCAGCCTAAGAAGGCTCCCTTTCCCCCAAAACCTCCTTTTGGCCAAAATTCCCCAACCAAAAAACTTGTTATTGGGGCTGGGCCTCTCCTTTAACACCAGCCCATCCTTTTTGTAACACCACCCTGT
  5   1   2       bld Kid                             IMAGE:7008948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCGAGGAGAAGAGCCCGACTGGCCCTGCCTCAAAGCGAGTCCGCACCGCGTACACAAGCGCGCAGCTGGTGGAACTGGAGAAAGAGTTTCACTTTAACCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAATTTACTCAACCTCACTGAGCGCCAGATCAAGATCTGGTTCCAGAACCGCAGAATGAAATACAAGAAGGATCAGAAAGCCAAAGGGATCATGCACTCCCCCGCGGGCCAGTCCCCAGACAGGAGCCCACCGCTCAGTGGATCCAACCATGTGGGATACTCCAGCCAACTATCAACTGTGAATAGCCTCAGCTACGATGCCCCTTCCCCAACCTCTTTTGCCAAATCCCAACAAAACATGTATGGGCTGGCTGCTTACACAGCACCTCTGAGCAGCTGCTTACCCCAGCAGAAAAGATACCCGGGGGCAGAGTATGAGCATCACACAATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCAGTTTATGTTGGAGGAAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCACCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCANATTCCAGGCAACCACCACCATGGACCGTGCGACCCCCATCCACATACACAGATTTAAGTTCCATCACACACTTCAGGGAGGATGCAGGAATCCCAACTCACCATCTCTAGAAACTGTGCTGAACGAGAAGAGAGACCGAAGA
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8533049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCCACCACTCAGTGGACCCAACCTTGTGGGATACTCCAGCCAGCTACCGACTGTGAATAGCTCAGCTATGATGCTCCTTCCCCAACCTCCTTTGCCAAATCCCAACAAAACATGTATGGGCTGGCTGCTTACACAGCACCTTTGAGCAGCTGCTTACCCCAGCAGAAAAGATACCCTGGGGCAGAGTATGAGCATCACACCATGCAGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGTT
  3   1   2      seed Tbd7                                 XL103e12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAACAAAACATGTATGGGCTGGCTGCTTACACAGCACCTTTGAGCAGCTGCTTACCCCAGCAGAAAAGATACCCTGGGGCAGAGTATGAGCATCACACCATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGT
  3   1   2       bld Neu4 5g3  in                    IMAGE:4084844.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAGAAAAGATACCTGGGGGCAGAGTATGAGCATCACACCATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTGGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGTGTTTGGTATTCTTATTTTGACCAAATGAGTATAAGAA
  3   1   2       bld Neu7 5g3  in                         XL013k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGCAGAGTATGAGCATCACACCATGCAGGGGAACAGCGGCTTTGCCAACCCCAATTTGCAGGGCAGCCCTGTTTATGTTGGAGGGAACTTTGTTGATTCGATGCCAGCCTCTGGCCCAATGTTCAACGTTGGCCACCTCTCCCATCCTTCTTCTGCCAGTGTGGACTACAGTTGTGCGGCTCAGATTCCAGGCAACCACCACCATGGACCGTGTGACCCCCACCCAACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAAGCCCCCAAACTCACACATCTCTAAGAAACTGTTGGCTGAAGAGAGAGAGAGCAATGATGTAAAACATACTCCTTTTAATTACCTCACTTTTTTCTGAAGGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGAATTAGTATTAGCCAGCGCGTCATGCAAAAAGGTGTTTCTTTTTCTTATTTT
  3   1   2       bld Neu7                                 XL026d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTCTGAGCTTCTTCAGCAGATCCATCCCTTCCTCCACATCATTTAACCAGTCCAACAAGCAATGGACTTTCCTATGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTNAGAGAATGAGNATTAGCCAGCGCGTCAGCAAAAAGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)