Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl335i08.3                            6 END     2          33       33                hypothetical protein LOC100036925 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012781060 Xl3.1-IMAGE:8543876.5 - 6 ESTs
                                                                       ......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8543876.5                                                                   GCCCTGCTCTGTGCTGCTGGAGCTGCAGACATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTCGGCCTGGCTCGTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCCTGGGAAGCACTACACAGACAACAGCTATAGACATGTGGGCTGTTGGTTGCATACTGGCTGAGCTC
                                                  Xl3.1-CHK-1012702929                                                                         CTCTGTGCTGCTGGAGCTGCAGACATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTCGGCCTGGCTCGTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCCTGGGAAGCACTACACAGACAACAGCTATAGACATGTGGGCTGTTGGTTGCATACTGGCTGAGCTCCTGGCT
                                                      consensus depths                                                                        2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     5     6     4     6     5     6     4     6     5     6     5     5     4     5     4     4     3     4     3     3     3     3     3     3
                                               BLH MIN      25     137                                                                   
  5   1   2      seed DMZ       out                        xl335i08.5p CGGGGAGGAGACTGAATGAGCTAGCACAGGTCCGCCTCCTCCGTGACATCATCAGCTGCTGCCCTAGCCCTGCTCTGTGCTGCTGGAGCTGCAGACATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTTGGCCTGGCTCGTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCCTGGGAAGCACTACAC
  5   1   2       bld Tail                            IMAGE:8543876.5p                               AAGNNGCCCATGCGTGCNNNANGNGTACCTAATAAATTCGTCCCCTGTGCTGCTGGAGCTGCAGACATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTCGGCCTGGCTCGTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCCTGGGAAGCACTACACAGACAACAGCTATAGACATGTGGGCTGTTGGTTGCATACTGGCTGAGCTCCTGGCTCCAAGCCGCTTCTCCCCAGAGTCAGAAATCAGCAGTTTGATTGATATACACTGCTTGCACACTATGAAACATTGGCAGCTTCCAAGCTGCTTAGTGTCATCACGTACTAGCAGCTCACAATTAACCATT
  5   1   2       bld Tail      out                   IMAGE:8542150.5p                                             GAGTACCTAAAAAATTCNTCCAGCCCTGCTCTGTGCTGCTGGAGCTGCAGACATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAATTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTTGGCCTGGCTCGTGCTTTTAGCACCCCTGTCAAGCAGATGACTCTCTAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCTTGGGAAGCACTACACAGACNACAGCTATAGACATGTGGGCTGTTGGTTGCATACTGGCTGAGCTCCTTGCTCACAGCCGCTTCTTCAGGAGTTCAGAATCCAGCAGATGATTTGATATACGCTGCTTGGCCACTAATGAACCTTTGGCAGCTTCCAAGCTGCTTTATGGTCATCAC
  5   1   2       bld Ooc3                            IMAGE:3436449.5p                                                                                                    ACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAATTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTCTGCCTGTCTCGTGCTTATAGCACTCCTGTAATATAGATGACTGCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGATCTATTGCATGGTAAGCCTACACAGACTACATCTATAGACATG
  5   1   2       bld Tbd7                                 XL067i22.5p                                                                                                                                            GGNCTGCAGGNAATTCGGCACGAGGNCGAAGTGTTAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTAAAGACTTGTTATTTTTTCCGTCCCACTCCAAGCTTGCTGAAATTACAGATGAGCAGATAACTGATTTCATATTTACCATACAGTAATATATTTGCTGTATACTAATTATAGCGAAAGGTTGTACATTTGCAGAGATTTATATGGAAGATGAGGATCCAGATCACAGGATAACATTCCCATCTTGATCTATAGAT
  5   1   2       bld Brn3                            IMAGE:8537093.5p                                                                                                                                                                                                                                                                                           GGACAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATCGCTGACTTCGGCCTGGCTCGTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGACTCTATGGTACCGGGCCCCTGAACTTCTCCTGGGAAGCACTACACAGACAACAGCTATAGACATGTGGGCTGTTGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCGCTTCTTCCAGGAAGTTCAGAAATCCAGCAGATTGATTTGATTATACAGCTGCTTGGCACACCTAATGAAAACATTTGGCCAGGCTTCTCAAAGCTGCCTTTAATTGGTCAATACACCGTATGTTATCAGCCTTACAACAATTTAAAACACAATTTTCCCCGGTTGTCTGAAGCCTGACTTCACTTACTTAATTTTCTATTTAGGTTGACCCCTAATATAAGCATTCCCTGAGGATTTCTTGCTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)