Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xl3.1-IMAGE:4756878.3                       3 END     3          50      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl329j14.3                           17 PI      94        739     1140                Unknown (protein for MGC:160982) [Xenopus laevis]
     3   0.0    0Xl3.1-xlk137n20ex.5                         2 PI      86          1      226                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012781354 Xl3.1-IMAGE:3400457-IMAGp.5 - 6 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3400457-IMAGp.5                                           AGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGCAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCCAAAAAGGAGAGAGAGAAAAGAAGGAAAGAGAAGGAAATCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCATCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGTGCCCAACTTTGGGAGAATTTTTTAGGCTTTCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCGCTGATAGGGAGTCCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCGCACCCTCACCACCAGATCCCCAGCCTGCCCAGTGGATTCTGTTCTAGTCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACGCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAAGAGGCAGCCAGAAAGTTTGGAGCTCAAAGTCTCCATGGAGCATTTGAAAAAAGCGACGGGAGTCAGTCAGACGGAGAAGATGGCAATAAGACCTACATAACCAAAGAGGGCACCTTACTGCCTTTCTCTACTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAAGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGATAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAAGAAGACACCCCAGAAGAAAGCC
                                                  Xl3.1-CHK-1012702897                                                 GAAGCTGCACATCCAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGCAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCCAAAAAGGAGAGAGAGAAAAGAAGGAAAGAGAAGGAAATCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCATCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGTGCCCAACTTTGGGAGAATTTTTTAGGCTTTCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCGCTGATAGGGAGTCCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCGCACCCTCACCACCAGATCCCCAGCCTGCCCAGTGGATTCTGTTCTAGTCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACGCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAAGAGGCAGCCAGAAAGTTTGGAGCTCAAAGTCTCCATGGAGCATTTGAAAAAAGCGACGGGAGTCAGTCAGACGGAGAAGATGGCAATAAGACCTACATAACCAAAGAGGGCACCTTACTGCCTTTCTCTACTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAAGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGATAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAAGAAGACACCCCAGAAGAAAGCCCCTCAA
                                                      consensus depths                                                2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     4     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     488     592                                           
                                               BLH MIN     488      76                                           
                                               BLH MPR     488      76                                           
                                               BLH OVR     488     600                                           
                                               CDS MIN     488      76                                           
                                               ORF LNG     488      32                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 7e-062     NP_990399.1 gastrulation brain homeo box 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 4e-074     NP_694496.1 gastrulation brain homeo box 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 5e-086     NP_001476.2 gastrulation brain homeo box 2 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Bt ==== 1e-086     XP_583937.2 PREDICTED: similar to homeobox protein GBX2 isoform 1 [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Cf ==== 1e-086     XP_543300.1 PREDICTED: similar to Homeobox protein GBX-2 (Gastrulation and brain-specific homeobox protein 2) [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 6e-087     NP_034392.1 gastrulation brain homeobox 2; stimulated by retinoic acid gene 7 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 9e-118     NP_001011472.1 hypothetical LOC496963 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 2e-125     NP_001083900.1 homeobox protein GBX-2b [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3400457-IMAGp.5                                                                                                                                                                                                                                    TGATAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------ATG------------------------ATGATGATG---------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Em10 5g                         IMAGE:8321500.5p CGGGGGACTGTAGTACAGTTTCGGTCCGGAGTTCGCGGGATGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGGAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCcaaaaaggagagagagaaaagaaggaaagagaaggaaATCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCGTCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGTGCCCAACTTTGGGAGAATTTTTTAGGCTTTCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCGCTGATAGGGAGTCCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCG
  5   1   2      seed Emb3 5g                IMAGE:3400457-IMAGp.IMAGp                                           AGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGCAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCcaaaaaggagagagagaaaagaaggaaagagaaggaaaTCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCATCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGTGCCCAACTTTGGGAGAATTTTTTAGGCTTTCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCGCTGATAGGGAGTCCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCGCACCCTCACCACCAGATCCCCAGCCTGCCCAGTGGATTCTGTTCTAGTCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACGCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAAGAGGCAGCCAGAAAGTTGGAGCTCAAAGTCTCCATGGAGCATTTGAAAAAAGCGACGGGAGTCAGTCAGACGGAG
  5   1   2       bld Emb3 5g3  out                   IMAGE:3400457.5p                                             AGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGCAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCcaaaaaggagagagagaaaagaaggaaagagaaggaaaTCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCATCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGTGCCCAACTTTGGGAGAATTTTTTAGGCTTTCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCACTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCCTTAGTATAGACTCGCTGATAGGGAGTCCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTGGCCCCCGCACCACCCC
  5   1   2       bld Eye1      out                   IMAGE:4756878.5p                                                              CAGGTCACCAAGGAAGAGAGAAGATCCCACCACACCGACTGCAAGTGGCAAAGCCCCGCCAAACACACAGGAACAAGGATCTGACAGTACAGACAGAGAGGAAAGTCCCCATTTCTGCTGGAAGAATCCCAACCACAGAAGGAGAGAGTCCACAGAAAGTATAAAGTGATAGCTGCGAGTGCAGGTCGGCCaaaaaggagagagagaaaagaaggaaagagaaggaaaTCGTAACTGCAAGGGGCAAAGTGAGACAATTCAGAGGAGACAATCCCTGTGTGACCCACACAGAACACTGCTTTGTATATCGGACTTTGGCATCCATCACCCACTTCTACCCTATTGCTGGCACTCTATCAATGGTCACTGTGACAGACTGTGGCTCTGGTGCCTACTGAGGGCTGTTCTAGTTGTTTGCGCCCAACTTTGGGAAAATTTTTTAGGCTTTCTTTGACTCC
  5   1   2       bld Em10                            IMAGE:8319602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATAGGGAGTCACCACAGCCCAGTCCAGGACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCGCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCGCACCCTCACCACCAGATCCCCAGCCTGCCCAGTGGATTCTGTTCTAGTCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACGCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAAGAGGCAGCCAGAAAGTTTGGAGCTCAAAGTCTCCATGGAGCATTTGAAAAAAGCGACGGGAGTCAGTCAGACGGAGAAGATGGCAATAAGACCTACATAACCAAAGAGGGCACCTTACTGCCTTTCTCTACTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAAGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGATAGTGACCTGGACTACAGTTCAAATGACAATATCTCCTGCCAAACTGCCCACAAAGAAGAAGACACCCCAGAAGAAAGCCCCCCACTCAAACCCCTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGGCGGAGGAAAACTGCC
  5   1   2       bld Emb3      out                   IMAGE:3398958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTTTGTATATACTGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCGCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTCCCTTCAGCGCACCCTCACCACCAGATCCCCAGCCTGCCCAGTGGATTCTGTTCTAGTCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACGCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAAGAGGCAGCCAGAAAGTTTGGAGCTCAAAGTCTCCATGGAGCATTTGAAAAAAGCGACGGGAGTCAGTCAGACGGAGAAGATGGCAATAAGACCTACATAACCAAAGAGGGCACCTTACTGCCTTTCTCTACTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAAGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGATAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAAGAAGACACCCCAGAAGAAAGCCCCTCAAACTCAAACTCTTTCTATAACAGCAACACCAGCTCCACGGGGAAGAACCGGCGAGGAGAACTGCCTTCACAGTGAACAACTGCTGTAACTAGAGAAAGAGTTCACTGCAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)