Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8528105.5                      12 END     1          16        8                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl232k11.5                           26 PI      77        109      485                MGC97660 protein [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:4683597-IMAGp.5                 3 PI      93         45      445                ETS-domain protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012781384 Xl3.1-IMAGE:6862945.5 - 6 ESTs
                                                                       .-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6862945.5                                                                                                                                    GGAACGGCGGCGGAGCTGTGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACGGTGCTGTCCCTCAGAGTGCTCCACCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTCCACTAGACTCCCCCAGCGAAGACGCCCACGGAAGCCGTTTCTCTGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAACGAGGTCACCGATCGCAAGACAAATGCATCGGAACAAGATGACCTTTCCTCCGATTGGCGGCGTAGTGCAGACCTTCTGGCCCCGCGTAATCCCATGGGTTTAGGCCATCGTGCTCTTCAGAAG
                                                  Xl3.1-CHK-1012702854                                                                                                                                          GCGGCGGAGCTGTGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACGGTGCTGTCCCTCAGAGTGCTCCACCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTCCACTAGACTCCCCCAGCGAAGACGCCCACGGAAGCCGTTTCTCTGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAACGAGGTCACCGATCGCAAGACAAATGCATCGGAACAAGATGACCTTTCCTCCGATTGGCGGCGTAGTGCAGACCTTCTGGCCCCGCGTAATCCCATGGGTTTAGGCCATCGTGCTCTTCAGAAGCACAAA
                                                      consensus depths                                                                                                                                         3     3     3     3     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     2     3     3     3     2     2     2     2     2     2
                                               BLH ATG      54     430                                                                                                                                    
                                               BLH MIN      54     107                                                                                                                                    
                                               BLH OVR      54     288                                                                                                                                    
                                               CDS MIN      54       1                                                                                                                                    
                                               EST CLI     -12       1                                                                                                                                    
                                               ORF LNG      54      12                                                                                                                                    
  5   1   2       bld Tbd7 5g                              XL107d05.5p TCTACGCGACGTCACTGACGACGCCCCCGCTAGCGCAGTGGGAGGTGGGAAGGCCAAGCCGGAAGTGGGATTAATAAGGCGGNAGGCACTTNCTGTTCGNTTGTATGTGGAGTCTGGAGAAGGAAACGACAGGAACGGCGGCGGAGCTGTGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGA
  5   1   2       bld Egg1 5x3  out                   IMAGE:3300390.5p                                                                                                                        GCACGAGGGACAGGAACGGCGGCGGAGCTGTGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGTGTACAAGGCGGAGTCAAGTCCCGGCTCCAGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACTTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACTGTGCTGTCCCTCA
  5   1   2      seed Emb1 5g                         IMAGE:6862945.5p                                                                                                                            TAACGACAGGAACGGCGGCGGAGCTGTGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACGGTGCTGTCCCTCAGAGTGCTCCGCCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTCCACTAGACTCCCCCAGCGAAGACGCCCACGGAAGCCGTTTCTCTGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAACGAGGTCACCGATCGCAAGACAAATGCATCGGAACAAGATGACCTTTCCTCCGATTGGCGGCGTAGTGCAGACCTTCTGGCCCCGCGTAATCCCATGGGTTTAGGCCATCGTGCTCTTCAGAAGCACAAATCCGATCTCATGCTCCCTGTTTTTCCGATGCCCAGGATGTATGCCGACCCCCCAACCATTGCTTGTCTCTCTCTGGCGCGGAGCTCCGAAATTCACTCACTGCCTACCTCATCGACGGCTTTCTTAACTCCGCTCAACGTTCAACCGGCTGCTACCGTC
  5   1   2       bld Ga12 5g3  out                        XL213h06.5p                                                                                                                                                 ACGAGGGACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACGGTGCTGTCCCTCAGAGTGCTCCACCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTCCACTAGACTCCCCCAGCGAAGACGCCCACGGAAGCCGGTTCTCTGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAACGAGGTCACCGATCGTAAGACAAATGCATCGGAACAAGATGACCTATCCTCCGATTGGCGGCGTAGTGCAGACCTTCTGGCCCCGCGTAATCCCAT
  5   1   2       bld Ga18 5g                             xlk7i07ex.5p                                                                                                                                                       GACCTAGCGGTCGATCCCGTCAGCAAGAAGGAAACATGAAAACTGGCTGTAGNATTGGGGAAAAGCCCAAANGAGGGGGAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGNNNNGTCCCGGCTCCCGACAGATCCAGCTGTGGNATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGNAGCAGGGGGAATATGGAGAGNTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGNTATGCCAAATTATCCTTTCATCAACATCCGACCTAATGGTGCTGTCCCTCAGAGTGCTCCGNCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTCCACTAGACTCCCCCAGCGAAGANGCCCACGGAAGCCGTTTCTCTGGGAACTCCACCGCGCAGNCCAGCCGCGAGTCTTTGAACGAGGNCACCGATCGCAAGACAAATGCATCGGAACAAGATGACCTTTCCTCCGATTGGCGGCGTAGTGNAGANCTTCTGGCCCCNCGTAATCCCATGGGTTTAGGNCATCGTGCTCTTCAGAAGCACAATCCGATCTCATGNNNCCTGTTTTTNCGATGCCAG
  5   1   2       bld Ga12 5x3  out                        XL168e20.5p                                                                                                                                                               CGGTCGATCCCGTAGCAAGAAGGAAACATGAAAACTGGCTGTAGCATTGGGGAAAAGCCCAAAGGAGGGGAAGGTTATCACTTCCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCCGGCTCCCGACAGATCCAGCTGTGGCATTTTATTTTGGAACTGCTGCAGAAGGAGGAGTTTCGACATGTTATTGCCTGGCAGCAGGGGGAATATGGAGAGTTTGTGATTAAAGACCCAGATGAGGTGGCCAGGCTATGGGGCCGGCGCAAATGCAAACCTCAGATGAACTACGACAAGCTGAGCCGAGCTCTGAGATACTATTACAACAAGCAGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTCAACTTCAACAAACTGGTTATGCCCAATTATCCTTTCATCAACATCCGACCTAACGGTGCTGTCCCTCAGAGTGCTCCACCTGTTCCAACTGCATCCTCCCATTTTCACTTCCCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)