Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 89%

 1012781487 Xl3.1-xl251j02.3 - 8 ESTs
                                                                       ........-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl251j02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGCAATTGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGCACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAATCAGAACAAAGGGAACCAT
                                                  Xl3.1-CHK-1012698501                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAATCAGAACAAAGGGAACCATGTTTGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     2     4     2     4     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     3     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     6     7     6     7     6     7     4     7     4     6     4     6     4     6     4     6     4     5     2     2     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                               BLH ATG      21     110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      21     245                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      21       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sp ---- 3e-024     NP_999815.2 homeobox protein Splox [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 6e-026     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN --- Ag ---- 2e-036     XP_001688962.1 AGAP004646-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 7e-037     NP_477201.1 Deformed CG2189-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-039     NP_001027781.2 hox4 protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 3e-052     XP_001789476.1 PREDICTED: homeobox A4 [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 2e-063     NP_034589.3 homeo box B4 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 5e-064     NP_076920.1 homeo box B4 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 1e-064     NP_001071582.1 homeobox B4 [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 6e-065     XP_851159.1 PREDICTED: similar to homeo box B4 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-067     NP_571193.1 homeo box B4a [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 6e-075     NP_990624.1 homeobox protein Hox-B4 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 3e-116     NP_001116487.1 homeobox B4 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 6e-135     NP_001089733.1 hypothetical protein LOC734796 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl251j02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Tad1                            IMAGE:6936991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGACAGTTAGTAGGAGGGTTTTAGGAAAACAGGGAAACGTCCAGGGCTCTAGGAATAAATTGGACCTTGtttttttttttGCAATTGGAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGAGCCAAAGTTTCCTCCCTGTCAGGAGTTTTCCCATAGTGATTACTCGCCCAGCGGCCAGTCTTTCAGCAGCTTTCAGCATGGGGCCCCCTACCCTCGATCCGTGTCCAACAACAACAATAACAACGCGCCCTACTCCTCCTGCCTGAGATCTGTGCGTCATGGCGCAAGGCTTCCACACTCATCTACACTTCTCCCTGGCGACAAAGCGCACGTGAAATCCCACATTACCCCCAGTCCATCCTGCAGCCTCATGTCCTCAGAGCACAAGTACCCCGACTCCCCGGAGCACGACCCAGTGTTGTAACCCTGGATGAAGAAAGCGCACATCTCCAAGGCCACTGACTCTGATGGATAAGCCAAGAGATCCCGCACATCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTATCTGTCCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTTTCTGAGCGACCAATCAAGATCTGGTTTCCGAACAGGAGGATGAAGTGGGAAGAAAGACCACAAGCTCCCCAATACCATGATCAAGTCTCACCCTTCTGTGAACCCTCCAATTTGCAGGGGGAATCCCC
  5   1   2       bld Em10      in                    IMAGE:7983325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTCTAGGAATAAATTGGACCTTGtttttttttGGGTGCAATTGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAGACCACAAGCTCCCCATACCAAGATCAAGTCTAACCCTTCTGTGACCTCCAAATTGCAGGTGGGT
  5   1   2       bld Neu7      in                         XL032c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGtttttttttGGGTGCAATTGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAGGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGGTAAGTCTCTTCTGTTCTACCTCTTATACCAGCAGTGGTGCGTCCTTTCAGATTTACTGTCGCCTGTTTGCAGGCCACTATAATTACATCCTCCATAAATTTTTACTGCTCTACTTGGCCAACTGCCTTTGAAGTAGAGTTACCATCCTCCTCCAATTTCTCCAGTGCCTCCTTTAAAGGTAGTGTGGGCCTTCCTGCATGAAGCTTTTATGATCTTCT
  3   1   2       bld Neu7      in                         XL032c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAAGGGTAAGTCTCTTCTGTTCTACCTCTTATACCAGCAGTGGTGCGTCCTTTCAGATTTACTGTCGCCTGTTTGCAGGCCACTATAATTACATCCTCCATAAATTTTTACTGCTCTACTTGGCCAACTGCCTTTGAAGTAGAGTTACCATCCTCCTCCAATTTCTCCAGTGCCTCCTTTAAAGTAGTGTGGGCCTTCCTGCATGAAGCTTTTATGATCTTCTAATTTGTGTTTAAGTGCCAGATTGGGTGCACTTTCACTGCTCTCTGTCACTTTAACGCAATACCATTCATATGATATGGGCAATGCTACACTCACAGGCCAATGCCGTTTTATTTGCTGTTTATGCCCAGTGACTGTATCCCCAGTAATAAAGTGGCCATTGTGTGTGATTCTCTTGCAGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGCACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAATCAGANCAAAGGGAACCATGNCTGCCAA
  3   1   2       bld Tbd7                                 XL094j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCAGCAGTGGTGCGTCCTTTCAGATTTACTGTCGCCTGTTTGCAGGCCACTATAATTACATCCTCCATAAATTTTTACTGCTCTACTTGGCCAACTGCCTTTGAAGTAGAGTTACCATCCTCCTCCAATTTCTCCAGTGCCTCCTTTAAAGTAGTGTGGGCCTTCCTGCATGAAGCTTTTATGATCTTCTAATTTGTGTTTAAGTGCCAGATTGGGTGCACTTTCACTGCTCTCTGTCACTTTAACGCAATACCATTCATATGATATGGGCAATGCTACACTCACAGGCCAATGCCGTTTTATTTGCTGTTTATGCCCAGTGACTGTATCCCCAGTAATAAAGTGGCCATTGTGTGTGATTCTCTTGCAGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGCACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAATCAGAACAAAGGGAACCATGTCTGCCAANACATCCCTAGGACTGC
  5   1   2       bld DMZ       in                         xl251j02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGGCAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAAT
  3   1   2      seed DMZ       in                         xl251j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAGAAGAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAGAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAGAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGGCAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAGACCACAAGCTCCCCAATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCGAATCA
  3   1   0       add Em10      in                    IMAGE:7983325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGCGGGCAGGTGAAATGGCACCTTGCGCTTTCGAGGACAATAAGATTGTTCCGAACTGGAGATGAGGGAAGAAGACCCAACTTCCCAATTCCAGATCAGTTTACCTTTCTGGGACCTCCAAATGCAGGGGGTCCCCGATCAGAACAAAGGGAACCATGTTTGCCAATGACATCCCTAGGACTGCTGAAAAAAAAAAAGATAAACTCGACTCTGGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGTCCCCCCCCCCGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGACGCCACCTGTCCCCATGACTGGATCCTTTCTCTCCCCTTTTTTTTCTGCGCGTTATATGGTGACCAAATGCATTGCGGTAGAGTGCTAGCTCTGAGGGTTTCTGTTGCGCAAATCTTATTGTTTGTCAAGTCATTGTTTTTCACTAGCAACCTGTCAACCTCAGACTGGGGACTTGCTTGGATCACACAGTTTGGGGCCTGAGATCACACAGAAGCCAAATTCACAATGCACAATTGTAGCTTCTGGCACTGTAATATATATTTAAGAAATTGATCCTGTCCTCTATAGTAGGCACCCCTACCCACCCAGTTTTATGTGGAAAATGCCTTTACCTGTGTACATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)