Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL055n06.3                            3 END     2          28       66                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012782167 Xl3.1-IMAGE:5542094.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5542094.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTCCAGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCCAATGACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGGTCTTTCTTTGTGGATCATAATAACCGGGTCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCGGACAAACGTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTCCCTTTGAGAGAAGGAAATGTTTATTACCCTCAGCTCCGGCCTGGTTATATCCCTATCCCCATCATGCATGAAGGTGTGGAAAACAGACAGCAGCACCCCTTCTATGCGCTCCATCAGCCGGGAATGCAACGAGTGCGCTGTGATCCTATATCTACGCAAAACCGACCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCACTGGCTACTCACTGCCACGTGGCTATATTTCTA
                                                  Xl3.1-CHK-1012699178                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCCAATGACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGGTCTTTCTTTGTGGATCATAATAACCGGGTCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCGGACAAACGTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTCCCTTTGAGAGAAGGAAATGTTTATTACCCTCAGCTCCGGCCTGGTTATATCCCTATCCCCATCATGCATGAAGGTGTGGAAAACAGACAGCAGCACCCCTTCTATGCGCTCCATCAGCCGGGAATGCAACGAGTGCGCTGTGATCCTATATCTACGCAAAACCGACCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCACTGGCTACTCACTGCCACGTGGCTATATTTCTATCCCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --AG--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C-----T----
                                               BLH ATG      59     466                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      59      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      59    1198                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      59       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -37       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      59      40                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                        PROTEIN --- Dm ---- 8e-007     NP_996116.1 CG7555-PD, isoform D [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 3e-007     NP_740775.1 ubiquitin-protein ligase with C2 and WW domains; suppressor of deltex; atrophin-1 interacting protein Nedd-4-like; itchy related (90.9 kD) (1B15) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- At ---- 2e-007     NP_001030896.1 SAC9 (suppressor of actin 9) [Arabidopsis thaliana] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-008     XP_587080.4 PREDICTED: neural precursor cell expressed, developmentally down-regulated 4-like isoform 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 7e-009     XP_001179460.1 PREDICTED: similar to Yap1 protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN -== Dr ==== 7e-028     NP_001003533.1 zgc:100859 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Cf ==== 1e-041     XP_544046.2 PREDICTED: similar to BAG-family molecular chaperone regulator-3 (BCL-2 binding athanogene-3) (BAG-3) (Bcl-2-binding protein Bis) (Docking protein CAIR-1) [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bt ---- 3e-045     NP_001075940.1 BCL2-associated athanogene 3 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-045     NP_038891.4 Bcl2-associated athanogene 3 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 1e-046     NP_004272.2 BCL2-associated athanogene 3 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 6e-051     XP_001233435.1 PREDICTED: BCL2-associated athanogene 3 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Xt ==== 7e-104     NP_001120299.1 hypothetical protein LOC100145358 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 1e-110     NP_001079487.1 BCL2-associated athanogene 3 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5542094.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAA------TAA---------------------ATG---------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2       bld Egg1 5g                            PBX0074F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTGTCAGTCTAAGAGAACCCGCAGTCCTTTCCAGACACTTCCAGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCCAATGACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGGTCTTTCTTTGTGGATCATAATAACCGGAGCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCAGCCAAACTTTGGCCAATGGCCCCTCGCAAGAGAG
  5   1   2       bld Emb4 5g                         IMAGE:5542453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTCCAGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCCAATGACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGGTCTTTCTTTGTGGATCACAATAACCGGAGCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCAGCCAAACTTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTGTCTTTGAGAGAAGGAAACGTGTATTACCCTCAGCTGCGGCCTGGTTATATCCCTATCCCCGTCATGCACGATGGTGTGGAAAACAGACAACAGCACCCCTTTTATTCTCTCCATCAGCCGGGAATGCAACGAGTGCGATGTGATCCTATTTCTACCCAAAACCGCCCCCAGTCCCCCCTGAGGAACTTTAATCGGCCTCAGTCCCCCGCATGGAGCTCGACTGAAGCACAAGCCGACAGACAAGGAATGGGGTCACCTTCACAGAGCGGATCCCCACAAGGACCTTCGCCCCCTCCGTCCATAGCAGAGTCTCAGAGTCACCTCTCTCAGTCCCCCAGCAGACAGGGGAGCTACTCACTGCCACGAGGATATATTCCCATCCCTGTGATCCACNGAGGAAATGTGCCGTGGCCTCCGTCACACGGTTTCCAGCAGAAGCCAAAGACCCATTACCCTCAAGGAACAGGCGATTACCAACCGCATTTATCCAGTGTTTCAGAAAAATTCAAGATGGAGAGAGACTCCAAAGCCCAGTCCCAGTCCTACCAGAAGCCACAGGCCCAAGCCCAAATATTCAAGGTAGAAAAAAGGGATT
  5   1   2      seed Emb4 5g                IMAGE:5542094-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCTCATAACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGCTCTTTCTTTGTGGATCATAATAACCGGGTCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCGGACAAACGTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTCCCTTTGAGAGAAGGAAATGTTTATTACCCTCAGCTCCGGCCTGGTTATATCCCTATCCCCATCATGCATGAAGGTGTGGAAAACAGACAGCAGCACCCCTTCTATGCGCTCCATCAGCCGGGAATGCAACGAGTGCGCTGTGATCCTATATCTACGCAAAACCGACCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCAC
  5   1   2       bld Emb4 5g                         IMAGE:5542094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCCCATTCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCTCATAACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGCTCTTTCTTTGTGGATCATAATAACCGGGTCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCGGACAAACGTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTCCCTTTGAGAGAAGGAAATGTTTATTACCCTCAGCTCCGGCCTGGTTATATCCCTATCCCCATCATGCATGAAGGTGTGGAAAACAGACAGCAGCACCCCTTCTATGCGCTCCATCAGCCGGGAATGCAACGAGTGCGCTGTGATCCTATATCTACGCAAAACCGACCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCACTGGCTACTCACTGCCACGTGGCTATATTTCTATCCCTGTGATCNCACCAGGGGGGCAATGCATCACCACGGCTTCCATCACACGGTTTCCAGCAGAAGCCCAAGAACCATTACCCACNAGGGAACGGGGTGATTACCAGCCGCAACCTATCCCGGGGTTTCACAAAATTCAAGAATGAAAAGGGACTCNAGGGNCACCACCGGGTCCAGGTCCACCAGAAGCCACAACCAAAGCCAACNTTCTGAGGGTAAAGAAAG
  5   1   2      skin Tbd7 5g                              XL057a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCTGGCGTCACTAAGTCCAATAAGTAGCGGAGAGAGTCGTGAGTATGGCCTATAGCCCCGTGTCCCGGAGCAGCACGAACACTACTCAAGGCTCACTCATGTCCAATGACAACCAGCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGGTCTTTCTTTGTGGATCACAATAACCGGAGCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCAGCCAAACTTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTGTCTTTGAGAGAAGGAAACGTGTATTACCCTCAG
  5   1   2       bld Tbd7      out                        XL066h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCCTCCCACCCGGCTGGGAGATGAAGTTGGACCCGCACACCGGCTGCTCCTTCTTTGTGGATCATAATAACCGGGTCACTACTTGGACTGACCCCAGACTGCAGGACACAGGCAAGGTCGGACAAACGTTGGCCAATGGCCCCTCGCAAGAGAGTCAAAAGCCCCTCCCTTTGAGAGAAGGAAATGTTTATTACCCTCAGCTCCGGCCTGGTTATATCCCTATCCCCATCATGCATGAAGGTGTGGAAAACAGACAGCAGCACCCCTTCTATGCGCTCCATCAGCCGGGAATGCAACGAGTGCGCTGTGATCCTATATCTACGCAAAACCGACCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCACTGGCTACTCACTGC
  5   1   2       bld Tbd7      out                        XL055n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCAGGNAATTCGGCACGAGGCCCCAGTCTCCCCTGAGGAACTTTAATAGGCCTCAGTCCCCCGCATGGAGCTCAACGGAAACACCGCAGGCCGACAGGCAAGGAATGGCGTCACCTTCACAGAGCGGATCCCCTCAAGGACCTTCGCCTCCTCCATCCATTGCAGAGTCTCACCTCTCTCAGTCCCCCAGCAGGCAGAGTGTCCTCTCTCAGTCTCCTGGTAGACAGAGCACTGGCTACTCACTGCCACGTGGCTATATTTCTATCCCTGTGATCCACCAGGGGGGCAATGCATCACCACGGCTTCCATCACACGGTTTCCAGCAGAAGCCCAAGACCCATTACCCACAAGGAACGGGTGATTACCAGCCGCACTATCCGGTGTTTCACAAAATTCAAGATGAGAGGGACTCAAGGCCACCACCGGTCCAGTCCACCAGAGCCACCACCAAGCCAACATCAAGTAGAGAAGGTTCACCTATCATAGTGCAGCATGCCATGGAGAAGCCTCAGGTCCATCAGATACCTCAACCCCGGGAGTCTCCACCAAAGCCTCCAGCAGAGAACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)