Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-PBX0050F06.5                          7 END     1          11       14                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6634968.5                       6 END     1          11       16                (no blast hit)
     3   2.0    0Xl3.1-xl237m10.3                            5 END     1          11       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:5080106.5.5                    30 PI      81        613      868                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:6956236.3.5                    22 PI      79        605      868                (no blast hit)
     6   0.0    0Xl3.1-XL447n14ex.3                         18 PI      86        697      854                Twinfilin-1
     7   0.0    0Xl3.1-IMAGE:7008455.5                      17 PI      82        625      868                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:3380248-IMAGp.5                 7 PI      81        608      868                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:4030817-IMAGp.5                 6 PI      80        616      861                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:6634794.5                       4 PI      79        615      863                (no blast hit)
    11   0.0    0Xl3.1-xlk117m15ex.3                         4 PI      79        618      863                MGC108344 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012782936 Xl3.1-IMAGE:7390103.5 - 9 ESTs
                                                                       -950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7390103.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACATTCAGCTGTTACAGGATACCATCAGCAAAATGGACCCTAATGAAGCAAGAATTTACATGAAGCAGTGTATTGACTCTGGACTTTGGGTTCCGAATTCAAAGGCAGCAGATGTTACAGAGTCTGAGGCTCCTGACTCAGAACCTGTATATGAAGCTGCTGACCAGCCGGAGACTCCGTAAGACGCCAGAAGTGGCCAATGGCATTAGGGAAGCTCCAGTTAAAAATAGTTGGAATTAGCTGGATATCTTCAGTGGGATTAGAGCCCCAACAGAGCTACTGGGCCACAAGAGATCCCGCTAATGCTATTTATCTCTCACTTTTTTTTTTTTTTTTTTAATACATGAACATCATAAGGATTACGTACACAGAAGCAGCACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCAACGACTAATTCTGCTAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGAAAAAAAAAAAACTCAAATATTTTGTGATTTATTATACCCCAAGGATGGAAAATGTCAAAATCTGAGAATCCGGCATCTCAGACCTGCTGAGGTTGTATATAAGCCAATGGGAGAAGTCCCAAAGATCTCCTGATCTGTGCTGGGTTTTGTGCAAAAATCTGAAGATTTTGTGGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAAATTG
                                                  Xl3.1-CHK-1012697319                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTGTTACAGGATACCATCAGCAAAATGGACCCTAATGAAGCAAGAATTTACATGAAGCAGTGTATTGACTCTGGACTTTGGGTTCCGAATTCAAAGGCAGCAGATGTTACAGAGTCTGAGGCTCCTGACTCAGAACCTGTATATGAAGCTGCTGACCAGCCGGAGACTCCGTAAGACGCCAGAAGTGGCCAATGGCATTAGGGAAGCTCCAGTTAAAAATAGTTGGAATTAGCTGGATATCTTCAGTGGGATTAGAGCCCCAACAGAGCTACTGGGCCACAAGAGATCCCGCTAATGCTATTTATCTCTCACTTTTTTTTTTTTTTTTTTAATACATGAACATCATAAGGATTACGTACACAGAAGCAGCACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCAACGACTAATTCTGCTAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGAAAAAAAAAAAACTCAAATATTTTGTGATTTATTATACCCCAAGGATGGAAAAAGTCAAAATCTGAGAATCCGGCATCTCAGACCTGCTGAGGTTGTATATAAGCCAATGGGAGAAGTCCCAAAGATCTCCTGATCTGTGCTGGGTTTTGTGCAAAAATCTGAAGATTTTGTGGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAATCTGAGTTTTCGGTCGGAGGATCCGACAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     6     5     8     5     8     5     8     5     8     5     8     3     6     3     5     3     5     3     4     4     4     2     4     2     4     2     4     3     4     2     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3
                                                                                                  PROTEIN --- Dm ---- 1e-007     NP_477006.1 Cdc37 CG12019-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                  PROTEIN --- Ag ---- 3e-008     XP_321151.4 AGAP001914-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                      PROTEIN --- Dr ---- 7e-011     NP_957332.1 similar to cell division cycle 37 homolog [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                       PROTEIN --- Gg ---- 3e-011     NP_990025.1 CDC37 protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 1e-011     XP_542071.2 PREDICTED: similar to Hsp90 co-chaperone Cdc37 (Hsp90 chaperone protein kinase-targeting subunit) (p50Cdc37) isoform 1 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                PROTEIN --- Bt ---- 5e-012     NP_001030415.1 CDC37 homolog [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================
                                                                                   PROTEIN --- Mm ---- 5e-012     NP_058022.1 cell division cycle 37 homolog (S. cerevisiae); cell division cycle 37 [Musmusculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                      PROTEIN --- Hs ---- 2e-012     NP_008996.1 CDC37 homolog [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                         PROTEIN --- Xt ---- 7e-020     AAI35958.1 CDC37 cell division cycle 37 homolog (S. cerevisiae) [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                         PROTEIN --- Xl ---- 3e-028     NP_001080276.1 CDC37 cell division cycle 37 homolog [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7390103.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA------------------------TAG------------TAA---TAG------------------------------TAG---------------------------------------ATG---------------------------------------TGA------TAA---------------------------TGA------------TAG------------ATG------------------TAA------TAG---ATG---------------------------------------TAA------------------------ATG---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------TAA------------------------------------------------ATG---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                          ...
  5   1   2       add Int2                            IMAGE:8821796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTAGGACCAGTAAAGTAAGAAAACCTTAATCAAAATCGTCCCCGCCTTTAATGATGAATTGGAATCCTTCAAGGGCAGAGTTAGGGAGAGAGCCAAGGTTCGAATAGAGAAGGCAATGAAGGAGTACGAGGAGGAAGAACGGAAAAAGAGACTTGGTCCGGGAGGGCTGGATCCTGTGGAGGTTTATGAATCTCTTCCACCTGAGCTTCAGAATTGTTTTGATACTAAAGACATTCAGCTGTTACAGGATACCATCAGCAAAATGGACCCTAATGAAGCAAGAATTTACATGAAGCAGTGTATTGACTCTGGACTTTGGGTTCCGAATTCAAAGGCAGCAGATGTTACAGAGTCTGAGGCTCCTGACTCAGAACCTGTATATGAAGCTGCTGACCAGCCGGAGACTCCGTAAGACGCCAGAAGTGGCCAATGGCATTAGGGAAGCTCCAGTTAAAAATAGTTGGAATTAGCTGGATATCTTCAGTGGGATTAGAGCCCCAACAGAGCTACTGGGCCACAAGAGATCCCGCTAATGCTATTTATCTCTCACttttttttttttttttttAATACATGAACATCATAAGGATTACGTACACAGAAGCAGCACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCCATGACAAATTCTGATAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCAACAAGGCCTGCTTATTGTCTGTTGGGTGTTAACTTGTGTTCTTTTTCATACAAAGAAAGCCAGCAGCACATTGACATAAGCGTTATTTATAAAGTCGGATTGCAAACCTGAAAATCTACTTTTATACCTATCAATCGACTTTAAGTGAAAACACTCAATATCGTGAATTATAATCCAGGGATGACAG
  5   1   0       add Tbd7                                 XL110n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGATACGAAAGACATTCAGCTGTTACAGGATACCATCAGCAAAATGGACCCTAATGAAGCAAGAATTTACATGAAGCANNGTATTGACTCTGGACTTTGGGTTCC
  3   1   2       bld Oo1  5g3  out                   IMAGE:3404752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAATGGCATTAGGGAAGCTCCAGTTAAAAATAGTTGGAATTAGCTGGATATCTTCAGTGGGATTAGAGCCCCAACAGAGCTAATGGGCCACAAGAGATCCCGCTAATGCTATTTATCTCTCACCTTTTTTTTTTTTTTTTTTTTAATACATGAACATCATAAGGATTACGTACACAGAAGCAGCACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCAACGACTAATTCTGCTAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGA
  5   1   2      seed Te2                             IMAGE:7390103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                tttttttttttAATACATGAACATCATAAGGATTACGTACACAGAAGCAGCACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCAACGACTAATTCTGCTAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGaaaaaaaaaaaaCTCAAATATTTTGTGATTTATTATACCCCAAGGATGGAAAATGTCAAAATCTGAGAATCCGGCATCTCAGACCTGCTGAGGTTGTATATAAGCCAATGGGAGAAGTCCCAAAGATCTCCTGATCTGTGCTGGGTTTTGTGCAAAAATCTGAAGATTTTGTGGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAAATTGTACTATTGAAATTTTCGTTTGGCTTTACAAttttttttttgttttATCCGCACTCAAATTTTCAGGAAAAACCTGCGTGAATTGGTCAGAGTAAT
  3  -1   2       bld Ga15                               XL475h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCTATGAATTGTGCATGAATAGATCATTAAGAGGATGGCACTCCTAGCCAACGACTAATTCTGCTAGCCAATGACAAATTCTGGTTTGCTAAATGTCAGTGGGATTGGGGTGTAATATGGGCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGAAAAAAAAAAAAAAGGGGGGGCCNCAGGGCCNCNCNACCCNCNAAAANTA
  5   1   2       bld Ga18      out                     xlk160a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTTTACTTATTGGCATTATGATTAGATTACCACAAGCCTGCTTATTGTCTGTTGGGTGTTCACTTGTGTTCTTTTTTCATACGAAGGAAAGCCAGCAGCACATTGACATTAAGGGGGTTACTTATTAAAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGaaaaaaaaaa
  5   1   2       add Egg1                               PBX0083A10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGGGGGTTACTTGTTGGAGTCCGAATGCCAAAAACCTGAAAAATTCTACTTTTTGTACTATCAAATCCGAATTTTAAGTGaaaaaaaaaaaaCTCAAATATTTTGTGATTTATTATACCCCAAGGATGGAAGGTGTCAGAGTCTGGGAATCCGGCGTCTCAGGCCTGCTGAGGTTGTATGTAAGCCAATGGGAGAAGTCCCAAAGATCTCCTGATCTGTGCTGGGTTTTGTGCAAAAATCTGAAGATTTTGCGGAATCTGAGTTTTCGGTCGGAGGATCCGACAGAATCTGAGTTTTCGGACGGAGGATCCGACAGAAATTG
  5   1   1       add Ooc1      out                     xlnoc002l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGAGTTAGGGGGTTATTTATTAAAGTCCAATTGCGAAAAATTCATGGttttttttaactattaaactgtaaaaatttagtaaaaaaaaaaCTTAAATTTTTTGTGATTTATTATACCCCGAGGATGGAAAAAGTCAGAATCCGAGAATCCGGCATCTTACACCTGCCGAGGTTGTATACAAGTCAATAGGAGCAGTCCCAAAGATATCCTAATCTGTGCCGGGTTTCGTACGATCCAAAtttttcatgagtttttcaagtttttttCCTGCACAGGAAATTTTAGGGAAAATGTATTGATAAATAA
  3   1   1       add Tbd7      out                        XL060l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTGCCAAAAACTCGGAAAATNTGAGTGTTTTGCCTATAAAATCCGAATTTTTCATGAAAAACTTGGATTTGGTTTTTTTTTAACCCTCAAATTTTTTGGGATTTAGTATACCCAAGGATGGAAAAAGTNTGAATNTGAAAATCCGGCATNTCAGACCTGCCAAGGTTGTATAGAAGTCAATGGGANAAGTCCTGAANATTTCCTGATCTGTGCTGGAATAATNTGAAGATTTTGTGGTTTAAAACAAAAATCAAAAAAATTTAGACGATTCAAATTTTTGGACAATTTTCATCATTTTTCCAATTTCTTTGGGGGAAATGGATTAATAAATAAGGGGAAATAACCCGTGCGGATTTGGTTGGGGTATATTTTAGAAAATATTCGGATTTTGATAAATAAATTTGATAAATAACCCCTANAGATTGCCTTTGTTGNACAGGCAACCCCCCCCCCAATTCCACCCCCTTTGGAAAGGTTATACAAGAAAAGCCACAGAGGAACGTTCTACTCTACTCCTGATGCTCTTACACAATGAATGTTGCATATAAAGAGCAGCTTGGTGCCTAACTTCTACTTGTTCTTATACAGATAAACCTCTCCCTAAACCAGCGGGCACATATTTTACATCTAGCTCCACANATCCTATAATAAACACATAAAGTCAGCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)